NEET · 2023

NEET 2023
Previous Year Questions

Complete NEET 2023 question paper — 200 questions across Physics, Chemistry and Biology with detailed solutions and AI explanations.

200

Total

51

Physics

46

Chemistry

103

Biology

Difficulty:200 questions

Previewing 10 questions free. Sign up to attempt all 200 NEET 2023 questions with AI explanations.

12023

Given below are two statements: Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside. Statement II : When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:

Easy NEET 2023Cell: The Unit of LifeClass 11Nucleosides and Nucleotides
22023

Which one of the following statements is correct?

Easy NEET 2023Human PhysiologyClass 11Mineral Nutrition and Physiology
32023

Given below are two statements : Statement I : The nutrient deficient water bodies lead to eutrophication. Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the above statements, choose the correct answer from the options given below :

Easy NEET 2023Ecology And EnvironmentClass 12Pollution
42023

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R : Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from the options given below :

Medium NEET 2023Plant PhysiologyClass 11Plant Life Cycles and Alternation of Generations
52023

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :

Medium NEET 2023ReproductionClass 12Embryo Sac and Double Fertilization
62023

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by

Easy NEET 2023Plant PhysiologyClass 11Transport in Plants
72023

Large, colourful, fragrant flowers with nectar are seen in :

Easy NEET 2023ReproductionClass 12Pollination
82023

The phenomenon of pleiotropism refers to

Medium NEET 2023Genetics And EvolutionClass 12Inheritance Patterns
92023

Which hormone promotes internode/petiole elongation in deep water rice?

Easy NEET 2023Plant PhysiologyClass 11Plant Growth Regulators
102023

Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?

Medium NEET 2023Ecology And EnvironmentClass 12Biodiversity Conservation
112023

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

Easy NEET 2023Biotechnology And Its ApplicationsClass 12DNA Fingerprinting and Molecular Techniques

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

122023

Which micronutrient is required for splitting of water molecule during photosynthesis?

Medium NEET 2023Plant PhysiologyClass 11Photosynthesis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

132023

Axile placentation is observed in

Medium NEET 2023Plant PhysiologyClass 11Plant Growth and Development

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

142023

The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

Medium NEET 2023Cell: The Unit of LifeClass 11Cell Division

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

152023

The reaction centre in PS II has an absorption maxima at

Easy NEET 2023Plant PhysiologyClass 11Photosynthesis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

162023

Unequivocal proof that DNA is the genetic material was first proposed by

Easy NEET 2023Genetics And EvolutionClass 12DNA as Genetic Material

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

172023

Among eukaryotes, replication of DNA takes place in -

Easy NEET 2023Cell: The Unit of LifeClass 11Cell Cycle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

182023

In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as -

Medium NEET 2023Structural Organisation In Animals And PlantsClass 11Plant Tissues and Tissue Culture

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

192023

Cellulose does not form blue colour with Iodine because

Medium NEET 2023Cell: The Unit of LifeClass 11Biomolecules

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

202023

Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?

Medium NEET 2023Plant PhysiologyClass 11Plant Growth Regulators

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

212023

Given below are two statements : Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height. Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling. In the light of the above statements, choose the most appropriate answer from the options given below :

Medium NEET 2023Plant PhysiologyClass 11Transport in Plants

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

222023

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

Hard NEET 2023Structural Organisation In Animals And PlantsClass 11Morphology of Flowering Plants

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

232023

Expressed Sequence Tags (ESTs) refers to

Medium NEET 2023Biotechnology And Its ApplicationsClass 12Biotechnology Tools

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

242023

Identify the correct statements : A. Detritivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below :

Hard NEET 2023Ecology And EnvironmentClass 12Ecosystem

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

252023

The thickness of ozone in a column of air in the atmosphere is measured in terms of :

Easy NEET 2023Ecology And EnvironmentClass 12Environmental Issues

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

262023

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below :

Medium NEET 2023Structural Organisation In Animals And PlantsClass 11Secondary Growth

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

272023

Which of the following stages of meiosis involves division of centromere?

Easy NEET 2023Cell: The Unit of LifeClass 11Cell Cycle and Meiosis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

282023

The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :

Easy NEET 2023Ecology And EnvironmentClass 12Biodiversity Conservation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

292023

How many ATP and NADPH₂ are required for the synthesis of one molecule of Glucose during Calvin cycle?

Medium NEET 2023Plant PhysiologyClass 11Photosynthesis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

302023

In the equation GPP − R = NPP GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is ________.

Medium NEET 2023Ecology And EnvironmentClass 12Ecosystem Productivity

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

312023

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

Easy NEET 2023Biotechnology And Its ApplicationsClass 12Recombinant DNA Technology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

322023

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Medium NEET 2023Genetics And EvolutionClass 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

332023

What is the function of tassels in the corn cob?

Easy NEET 2023ReproductionClass 12Sexual Reproduction in Flowering Plants

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

342023

Identify the pair of heterosporous pteridophytes among the following :

Medium NEET 2023Plant PhysiologyClass 11Pteridophytes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

352023

In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.

Easy NEET 2023Biotechnology And Its ApplicationsClass 12Biotechnological Tools

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

362023

Given below are two statements : Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II : Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below :

Easy NEET 2023Structural Organisation In Animals And PlantsClass 11Plant Morphology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

372023

Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

Medium NEET 2023Genetics And EvolutionClass 12Genetic Linkage and Mapping

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

382023

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :

Medium NEET 2023Cell: The Unit of LifeClass 11Cellular Respiration

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

392023

Which one of the following statements is NOT correct?

Medium NEET 2023Ecology And EnvironmentClass 12Environmental Issues

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

402023

How many different proteins does the ribosome consist of?

Easy NEET 2023Cell: The Unit of LifeClass 11Ribosome Structure

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

412023

Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below :

Medium NEET 2023Genetics And EvolutionClass 12Human Genetic Disorders

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

422023

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2023Cell: The Unit of LifeClass 11Cellular Respiration

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

432023

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves. In the light of the above statements, choose the correct answer from the options given below :

Medium NEET 2023ReproductionClass 12Flowering Plants

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

442023

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below :

Medium NEET 2023ReproductionClass 12Gymnosperms

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

452023

Match List I with List II : Choose the correct answer from the options given below :

Easy NEET 2023Plant PhysiologyClass 11Transport in Plants

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

462023

Which of the following combinations is required for chemiosmosis?

Medium NEET 2023Plant PhysiologyClass 11Photosynthesis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

472023

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

Easy NEET 2023Biology And Human WelfareClass 12Microbes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

482023

Identify the correct statements : A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues exterior to vascular cambium. D. Bark refers to periderm and secondary phloem. E. Phellogen is single-layered in thickness. Choose the correct answer from the options given below :

Medium NEET 2023Structural Organisation In Animals And PlantsClass 11Plant Morphology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

492023

Match List I with List II : Choose the correct answer from the options given below :

Easy NEET 2023Cell: The Unit of LifeClass 11Cell Cycle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

502023

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2023Ecology And EnvironmentClass 12Species Interactions

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

512023

Given below are two statements : Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below :

Medium NEET 2023Ecology And EnvironmentClass 12Population Interactions

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

522023

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2023Plant PhysiologyClass 11Mineral Nutrition

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

532023

Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell. B. Cutting of DNA at specific location by restriction enzyme. C. Isolation of desired DNA fragment. D. Amplification of gene of interest using PCR. Choose the correct answer from the options given below :

Easy NEET 2023Biotechnology And Its ApplicationsClass 12Recombinant DNA Technology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

542023

Match List I with List II. Choose the correct answer from the options below:

Easy NEET 2023ReproductionClass 12Reproductive Health and Contraceptive Methods

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

552023

Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2023ReproductionClass 12Human Reproductive System

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

562023

Which of the following statements is correct?

Medium NEET 2023Ecology And EnvironmentClass 12Environmental Issues

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

572023

Which one of the following symbols represents mating between relatives in human pedigree analysis?

Medium NEET 2023Genetics And EvolutionClass 12Human Pedigree Analysis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

582023

Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

Easy NEET 2023Biology And Human WelfareClass 12Sexually Transmitted Diseases

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

592023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Biology And Human WelfareClass 12Drugs and Alcohol Abuse

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

602023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Structural Organisation In Animals And PlantsClass 11Joints

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

612023

Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal) Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two subunits of β type). In the light of the above statements, choose the correct answer from the options given below:

Easy NEET 2023BiomoleculesClass 12Proteins and Haemoglobin

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

622023

Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic Reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:

Easy NEET 2023Cell: The Unit of LifeClass 11Cell Organelles and Endomembrane System

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

632023

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2023Molecular Basis of InheritanceClass 12RNA World and Evolution

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

642023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Chemical Coordination and IntegrationClass 11Human Hormones

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

652023

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2023Human ReproductionClass 12Implantation and Pregnancy

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

662023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Human Health and DiseaseClass 12Diseases Caused by Pathogens

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

672023

Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:

Easy NEET 2023Biotechnology And Its ApplicationsClass 12Enzymes and Enzyme Inhibition

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

682023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Structural Organisation In Animals And PlantsClass 11Animal Anatomy and Excretory Structures

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

692023

Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

Easy NEET 2023Biotechnology And Its ApplicationsClass 12Molecular Diagnostic Techniques

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

702023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Ecology And EnvironmentClass 12Organism Interactions

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

712023

Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below:

Easy NEET 2023Structural Organisation In Animals And PlantsClass 11Animal Tissues

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

722023

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

Easy NEET 2023Cell: The Unit of LifeClass 11Cell organelles

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

732023

Match List I with List II with respect to human eye. Choose the correct answer from the options given below:

Medium NEET 2023Human PhysiologyClass 11Nervous system

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

742023

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

Medium NEET 2023EvolutionClass 12Natural selection

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

752023

Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between the menarche and menopause. Choose the most appropriate answer from the options given below:

Medium NEET 2023ReproductionClass 12Human reproduction

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

762023

Vital capacity of lung is ________.

Easy NEET 2023Human PhysiologyClass 11Respiration

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

772023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Human PhysiologyClass 11Circulation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

782023

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R: Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below:

Easy NEET 2023ReproductionClass 12Reproductive Health

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

792023

Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-

Easy NEET 2023Human PhysiologyClass 11Digestion

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

802023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Biotechnology And Its ApplicationsClass 12Recombinant DNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

812023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Human PhysiologyClass 11Digestion

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

822023

Which of the following functions is carried out by cytoskeleton in a cell?

Easy NEET 2023Cell: The Unit of LifeClass 11Cell Organelles and Cytoskeleton

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

832023

Given below are statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Nephrons are of two types: Cortical and Juxta medullary, based on their relative position in cortex and medulla. Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2023Human PhysiologyClass 11Excretion

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

842023

Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations. In the light of the above statements, choose the most appropriate answer from the options given below:

Easy NEET 2023Biology And Human WelfareClass 12Pollution

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

852023

Broad palm with single palm crease is visible in a person suffering from-

Easy NEET 2023Genetics And EvolutionClass 12Human Genome Project

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

862023

Radial symmetry is NOT found in adults of phylum ______.

Easy NEET 2023Diversity In Living WorldClass 11Plant and animal classification

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

872023

In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

Medium NEET 2023Biology And Human WelfareClass 12AIDS

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

882023

Which of the following is not a cloning vector?

Easy NEET 2023Biotechnology And Its ApplicationsClass 12Recombinant DNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

892023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Ecology And EnvironmentClass 12Population interactions

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

902023

Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart. E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below:

Medium NEET 2023Diversity In Living WorldClass 11Plant and animal classification

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

912023

The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :

Easy NEET 2023Human PhysiologyClass 11Nervous System

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

922023

The unique mammalian characteristics are:

Easy NEET 2023Structural Organisation In Animals And PlantsClass 11Cockroach Anatomy

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

932023

Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of R.B.Cs formation Choose the correct answer from the options given below:

Medium NEET 2023Human PhysiologyClass 11Endocrine Glands

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

942023

Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:

Medium NEET 2023Cell: The Unit of LifeClass 11Cell Cycle and Meiosis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

952023

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2023Structural Organisation In Animals And PlantsClass 11Animal Tissues

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

962023

Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

Easy NEET 2023Structural Organisation In Animals And PlantsClass 11Cockroach Anatomy

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

972023

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?

Medium NEET 2023Cell: The Unit of LifeClass 12DNA Structure

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

982023

In cockroach, excretion is brought about by- A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below:

Medium NEET 2023Structural Organisation In Animals And PlantsClass 11Cockroach Anatomy

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

992023

Given below are two statements: Statement I: During G0G_0 phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:

Easy NEET 2023Cell: The Unit of LifeClass 11Cell Cycle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1002023

Which one of the following is NOT an advantage of inbreeding?

Easy NEET 2023Genetics And EvolutionClass 12Inbreeding

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1012023

Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below:

Medium NEET 2023Human PhysiologyClass 11Excretory Products and their Elimination

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1022023

Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:

Medium NEET 2023Human PhysiologyClass 11Locomotion and Movement

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1032023

Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs. B. Basophils secrete histamine, serotonin and heparin. C. Basophils are involved in inflammatory response. D. Basophils have kidney shaped nucleus. E. Basophils are agranulocytes. Choose the correct answer from the options given below:

Medium NEET 2023Human PhysiologyClass 11Body Fluids and Circulation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1042023

Which of the following reactions will NOT give primary amine product?

Medium NEET 2023AminesClass 12Amines

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1052023

Match List-I with List-II. Choose the correct answer from the options given below:

Easy NEET 2023P-Block ElementsClass 11Carbon

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1062023

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic. Reason R : The deep blue solution is due to the formation of amide. In the light of above statements, choose the correct answer from the options given below:

Medium NEET 2023HydrogenClass 11Liquid Ammonia

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1072023

In Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe³⁺ because of the formation of -

Hard NEET 2023Coordination CompoundsClass 12Complex Compounds

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1082023

The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm⁻¹ cm⁻¹ and resistance of cell containing the solution at 25°C is 60 ohm. The value of cell constant is -

Medium NEET 2023ElectrochemistryClass 12Conductance

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1092023

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A reaction can have zero activation energy. Reason R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy. In the light of above statements, choose the correct answer from the options given below :

Easy NEET 2023Chemical KineticsClass 12Activation Energy

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1102023

Which one is an example of heterogenous catalysis?

Easy NEET 2023Surface ChemistryClass 12Catalysis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1112023

The given compound is an example of ________.

Medium NEET 2023Haloalkanes And HaloarenesClass 12Classification of Halo Compounds

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1122023

Identify the product in the following reaction:

Medium NEET 2023AminesClass 12Diazonium Salts

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1132023

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Helium is used to dilute oxygen in diving apparatus. Reason R : Helium has high solubility in O₂. In the light of the above statements, choose the correct answer from the options given below:

Easy NEET 2023SolutionsClass 12Henry's Law

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1142023

A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is AₓBᵧ, then the value of x + y is:

Hard NEET 2023Solid StateClass 12Voids in Crystal Structure

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1152023

The relation between nmn_m, (nmn_m = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is

Easy NEET 2023Structure of AtomClass 11Quantum Numbers

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1162023

Amongst the following, the total number of species NOT having eight electrons around central atom in its outermost shell, is NH3NH_3, AlCl3AlCl_3, BeCl2BeCl_2, CCl4CCl_4, PCl5PCl_5 :

Medium NEET 2023Chemical Bonding and Molecular StructureClass 11Octet Rule

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1172023

The correct order of energies of molecular orbitals of N2N_2 molecule, is :

Hard NEET 2023Chemical Bonding and Molecular StructureClass 11Molecular Orbital Theory

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1182023

The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are:

Medium NEET 2023Chemical Bonding and Molecular StructureClass 11Valence Bond Theory

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1192023

Intermolecular forces are forces of attraction and repulsion between interacting particles that will include : A. dipole-dipole forces. B. dipole-induced dipole forces. C. hydrogen bonding. D. covalent bonding. E. dispersion forces. Choose the most appropriate answer from the options given below :

Easy NEET 2023Chemical Bonding and Molecular StructureClass 11Intermolecular Forces

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1202023

Which of the following statements are NOT correct? A. Hydrogen is used to reduce heavy metal oxides to metals. B. Heavy water is used to study reaction mechanism. C. Hydrogen is used to make saturated fats from oils. D. The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element. E. Hydrogen reduces oxides of metals that are more active than iron. Choose the most appropriate answer from the options given below :

Medium NEET 2023HydrogenClass 11Uses of Hydrogen

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1212023

Which amongst the following molecules on polymerization produces neoprene?

Medium NEET 2023HydrocarbonsClass 11Alkenes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1222023

Some tranquilizers are listed below. Which one from the following belongs to barbiturates?

Easy NEET 2023Chemistry In Everyday LifeClass 12Medicines

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1232023

The element expected to form largest ion to achieve the nearest noble gas configuration is:

Easy NEET 2023Classification of Elements and Periodicity in PropertiesClass 11Ionization Enthalpy and Electron Gain

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1242023

Select the correct statements from the following: A. Atoms of all elements are composed of two fundamental particles. B. The mass of the electron is 9.10939 × 10⁻³¹ kg. C. All the isotopes of a given element show same chemical properties. D. Protons and electrons are collectively known as nucleons. E. Dalton’s atomic theory regarded the atom as an ultimate particle of matter. Choose the correct answer from the options given below:

Medium NEET 2023Some Basic Concepts of ChemistryClass 11Atomic Theory

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1252023

Consider the following reaction and identify the product (P).

Medium NEET 2023Alcohols, Phenols and EthersClass 12Alcohol Reactions

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1262023

The stability of Cu²⁺ is more than Cu⁺ salts in aqueous solution due to:

Medium NEET 2023The d- and f-Block ElementsClass 12Transition Elements

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1272023

Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is:

Easy NEET 2023HydrocarbonsClass 11Preparation and Properties of Alkanes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1282023

Amongst the given options which of the following molecules / ion acts as a Lewis acid?

Easy NEET 2023Chemical Bonding and Molecular StructureClass 11Lewis Acids and Bases

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1292023

Identify product (A) in the following reaction:

Medium NEET 2023Aldehydes, Ketones and Carboxylic AcidsClass 12Clemmensen Reduction

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1302023

Taking stability as the factor, which one of the following represents correct relationship?

Medium NEET 2023The d- and f-Block ElementsClass 12Inert Pair Effect and Stability

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1312023

Homoleptic complex from the following complexes is :

Easy NEET 2023Coordination CompoundsClass 12Homoleptic Complexes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1322023

Complete the following reaction: [C] is ________. Complete the following reaction: [C] is ________.

Medium NEET 2023Aldehydes, Ketones and Carboxylic AcidsClass 12Cyanohydrin Formation and Hydrolysis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1332023

The right option for the mass of CO₂ produced by heating 20 g of 20% pure limestone is: (Atomic mass of Ca = 40)

Easy NEET 2023Some Basic Concepts of ChemistryClass 11Stoichiometry

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1342023

For a certain reaction, the rate = k[A]²[B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would:

Easy NEET 2023Chemical KineticsClass 12Rate law

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1352023

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : In equation ΔᵣG = −nFEcell, value of ΔᵣG depends on n. Reason R : Ecell is an intensive property and ΔᵣG is an extensive property. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2023ElectrochemistryClass 12EMF

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1362023

Match List-I with List-II : Choose the correct answer from the options given below :

Medium NEET 2023P-Block ElementsClass 12Oxoacids of Sulphur

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1372023

Which of the following statements are INCORRECT? A. All the transition metals except scandium form MO oxides which are ionic. B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc₂O₃ to Mn₂O₇. C. Basic character increases from V₂O₃ to V₂O₄ to V₂O₅. D. V₂O₄ dissolves in acids to give VO₄³⁻ salts. E. CrO is basic but Cr₂O₃ is amphoteric. Choose the correct answer from the options given below :

Hard NEET 2023The d- and f-Block ElementsClass 12Transition Metal Oxides

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1382023

Which complex compound is most stable?

Medium NEET 2023Coordination CompoundsClass 12Ligands

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1392023

Consider the following compounds/species: The number of compounds/species which obey Huckel's rule is ____. Consider the following compounds/species: The number of compounds/species which obey Huckel's rule is ____.

Hard NEET 2023Organic Chemistry – Basic PrinciplesClass 11Aromatic Hydrocarbons

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1402023

What fraction of one edge centred octahedral void lies in one unit cell of fcc?

Medium NEET 2023Solid StateClass 12Unit Cell

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1412023

Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?

Easy NEET 2023ThermodynamicsClass 11Enthalpy

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1422023

On balancing the given redox reaction, a Cr₂O₇²⁻ + b SO₃²⁻(aq) + c H⁺(aq) → 2a Cr³⁺(aq) + b SO₄²⁻(aq) + c/2 H₂O(l) the coefficients a, b and c are found to be, respectively -

Medium NEET 2023Redox ReactionsClass 11Balancing redox reactions

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1432023

The equilibrium concentrations of the species in the reaction A + B ⇌ C + D are 2, 3, 10 and 6 mol L⁻¹, respectively at 300 K. ΔG° for the reaction is (R = 2 cal/mol K)

Medium NEET 2023EquilibriumClass 11Chemical equilibrium

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1442023

Pumice stone is an example of -

Easy NEET 2023Surface ChemistryClass 12Colloids

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1452023

Identify the major product obtained in the following reaction:

Medium NEET 2023Aldehydes, Ketones and Carboxylic AcidsClass 12Aldehydes and Ketones Reactions

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1462023

Identify the final product [D] obtained in the following sequence of reactions.

Medium NEET 2023Alcohols, Phenols and EthersClass 12Alcohol Dehydration and Organic Conversions

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1472023

Which amongst the following will be most readily dehydrated under acidic conditions?

Hard NEET 2023Alcohols, Phenols and EthersClass 12Dehydration of Alcohols

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1482023

Consider the following reaction: Consider the following reaction:

Medium NEET 2023Alcohols, Phenols and EthersClass 12Ethers

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1492023

The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is :

Medium NEET 2023Isolation Of ElementsClass 12Iron Extraction

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1502023

Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is :

Easy NEET 2023Properties Of Bulk MatterClass 11Stress

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1512023

The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :

Medium NEET 2023System of Particles and Rotational MotionClass 11Moment of Inertia and Radius of Gyration

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1522023

The equivalent capacitance of the system shown in the following circuit is :

Medium NEET 2023Electric Charges and FieldsClass 12Capacitance Combination

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1532023

A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :

Easy NEET 2023Laws of MotionClass 11Force and Change in Momentum

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1542023

If SEdS=0\oint_S \vec{E} \cdot d\vec{S} = 0 over a surface, then:

Medium NEET 2023Electric Charges and FieldsClass 12Electric Flux and Gauss Theorem

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1552023

The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be :

Easy NEET 2023Oscillations and WavesClass 11Potential Energy of a Spring

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1562023

If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by :

Hard NEET 2023Current ElectricityClass 12Wheatstone Bridge and Galvanometer

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1572023

A 12 V, 60 W lamp is connected to the secondary of a step down transformer, whose primary is connected to mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?

Medium NEET 2023Electromagnetic InductionClass 12Transformer

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1582023

A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?

Easy NEET 2023Semiconductor ElectronicsClass 12PN Junction Diode

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1592023

Light travels a distance x in time t1t_1 in air and 10x in time t2t_2 in another denser medium. What is the critical angle for this medium?

Medium NEET 2023OpticsClass 12Refraction

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1602023

Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) Ω. The colour of third band must be :

Easy NEET 2023Current ElectricityClass 12Resistance

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1612023

Given below are two statements: Statement I : Photovoltaic devices can convert optical radiation into electrical energy. Statement II : Zener diode is designed to operate under reverse bias in breakdown region. In the light of the above statements, choose the most appropriate answer from the options given below :

Medium NEET 2023Semiconductor ElectronicsClass 12Photovoltaic Cell and Zener Diode

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1622023

The magnetic energy stored in an inductor of inductance 4 μH carrying a current of 2 A is :

Easy NEET 2023Electromagnetic InductionClass 12Inductance

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1632023

The angular acceleration of a body, moving along the circumference of a circle, is :

Easy NEET 2023System of Particles and Rotational MotionClass 11Rotational Motion

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1642023

A Carnot engine has an efficiency of 50% when the source is at a temperature 327°C. The temperature of the sink is :

Medium NEET 2023ThermodynamicsClass 11Heat Engines

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1652023

Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be : (G = gravitational constant)

Hard NEET 2023GravitationClass 11Gravitational Potential

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1662023

A vehicle travels half the distance with speed v and the remaining distance with speed 2v. Its average speed is:

Medium NEET 2023KinematicsClass 11Average Speed

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1672023

The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly : (surface tension of soap solution = 0.03 Nm1N m^−1)

Medium NEET 2023Properties Of Bulk MatterClass 11Surface tension

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1682023

The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:

Easy NEET 2023Dual Nature of Radiation and MatterClass 12X-rays

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1692023

The half life of a radioactive substance is 20 minutes. In how much time, the activity of the substance drops to (1/16)th of its initial value?

Medium NEET 2023Atoms And NucleiClass 12Radioactivity

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1702023

A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be:

Medium NEET 2023Units and MeasurementsClass 11Errors and significant figures

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1712023

In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency 2.0 × 10¹⁰ Hz and amplitude 48 V m⁻¹. Then the amplitude of oscillating magnetic field is : (Speed of light in free space = 3 × 10⁸ m s⁻¹)

Medium NEET 2023Electromagnetic WavesClass 12Electromagnetic waves

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1722023

The temperature of a gas is -50° C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?

Easy NEET 2023Electric Charges and FieldsClass 12Gauss Theorem

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1732023

An ac source is connected to a capacitor C. Due to decrease in its operating frequency :

Easy NEET 2023Electric Charges and FieldsClass 12Capacitors

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1742023

For Young’s double slit experiment, two statements are given below: Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant. Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2023OpticsClass 12Interference

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1752023

In hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the Brackett series is :

Medium NEET 2023Atoms And NucleiClass 12Bohr model

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1762023

The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?

Easy NEET 2023Dual Nature of Radiation and MatterClass 12Photoelectric effect

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1772023

The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :

Easy NEET 2023Units and MeasurementsClass 11Errors and significant figures

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1782023

In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 μF and resistance R is 100 Ω. The frequency at which resonance occurs is :

Medium NEET 2023Electromagnetic InductionClass 12AC circuits

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1792023

The venturi-meter works on :

Easy NEET 2023Properties Of Bulk MatterClass 11Bernoulli theorem

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1802023

The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is :

Medium NEET 2023Oscillations and WavesClass 11Wave motion

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1812023

An electric dipole is placed at an angle of 3030^\circ with an electric field of intensity 2×105N C12 \times 10^5\, \text{N C}^{-1}. It experiences a torque equal to 4N m4\, \text{N m}. Calculate the magnitude of charge on the dipole, if the dipole length is 2cm2\, \text{cm}.

Medium NEET 2023Electric Charges and FieldsClass 12Electric Dipole

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1822023

The magnitude and direction of the current in the following circuit is :

Hard NEET 2023Current ElectricityClass 12Kirchhoff’s laws

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1832023

The net magnetic flux through any closed surface is :

Easy NEET 2023Electromagnetic InductionClass 12Magnetic flux

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1842023

A bullet is fired from a gun at the speed of 280 m s⁻¹ in the direction 30° above the horizontal. The maximum height attained by the bullet is : (g = 9.8 m s⁻², sin 30° = 0.5)

Medium NEET 2023KinematicsClass 11Projectile motion

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1852023

Two thin lenses are of same focal lengths (f), but one is convex and the other is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :

Easy NEET 2023OpticsClass 12Lens Equation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1862023

The net impedance of circuit (as shown in figure) will be :

Medium NEET 2023Electromagnetic InductionClass 12AC Circuits

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1872023

The x-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at t = 2 s is :

Medium NEET 2023Oscillations and WavesClass 11SHM

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1882023

An electric dipole is placed as shown in the figure. The electric potential (in 10² V) at point P due to the dipole is (ε₀ = permittivity of free space and 1/4π ε₀ = K) :

Medium NEET 2023Electric Charges and FieldsClass 12Electric Dipole

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1892023

A bullet from a gun is fired on a rectangular wooden block with velocity uu. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes u3\frac{u}{3}. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is:

Medium NEET 2023Laws of MotionClass 11Retardation and Motion in a Medium

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1902023

In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?

Hard NEET 2023OpticsClass 12Lens Maker Formula

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1912023

For the following logic circuit, the truth table is:

Easy NEET 2023Semiconductor ElectronicsClass 12Logic Gates

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1922023

A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s⁻¹. The ball strikes the water surface after 4 s. The height of bridge above water surface is (Take g = 10 m s⁻²):

Easy NEET 2023KinematicsClass 11Motion in Straight Line

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1932023

10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those resistors are connected in parallel to the same battery, the current is increased n times. The value of n is:

Medium NEET 2023Current ElectricityClass 12Resistance

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1942023

A wire carrying a current II along the positive xx-axis has length LL. It is kept in a magnetic field B=(2i^+3j^4k^)T\vec{B} = (2\hat{i} + 3\hat{j} - 4\hat{k})\,\text{T}. The magnitude of the magnetic force acting on the wire is:

Medium NEET 2023Moving Charges and MagnetismClass 12Magnetic Force on a Current Carrying Conductor

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1952023

A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G the universal constant of gravitation, the quantity 3π/Gd represents:

Medium NEET 2023GravitationClass 11Satellites

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1962023

Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s⁻²).

Easy NEET 2023Laws of MotionClass 11Friction

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1972023

The resistance of platinum wire at 0°C is 2Ω and 6.8Ω at 80°C. The temperature coefficient of resistance of the wire is:

Medium NEET 2023Current ElectricityClass 12Resistance and Resistivity

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1982023

The radius of inner most orbit of hydrogen atom is 5.3 × 10⁻¹¹ m. What is the radius of third allowed orbit of hydrogen atom?

Easy NEET 2023Atoms And NucleiClass 12Bohr Model

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1992023

A very long conducting wire is bent in a semi-circular shape from A to B as shown in the figure. The magnetic field at point P for steady current configuration is given by:

Hard NEET 2023Moving Charges and MagnetismClass 12Magnetic Field due to Current Carrying Conductor

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

2002023

Which amongst the following options is correct graphical representation of Boyle’s Law?

Medium NEET 2023Kinetic TheoryClass 11Gas Laws

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

Unlock All NEET 2023 Questions

200 questions · AI explanations · Progress tracking · Free forever