Previewing 10 questions free. Sign up to attempt all 200 NEET 2023 questions with AI explanations.
Given below are two statements: Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside. Statement II : When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:
Which one of the following statements is correct?
Given below are two statements : Statement I : The nutrient deficient water bodies lead to eutrophication. Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the above statements, choose the correct answer from the options given below :
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R : Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from the options given below :
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
Large, colourful, fragrant flowers with nectar are seen in :
The phenomenon of pleiotropism refers to
Which hormone promotes internode/petiole elongation in deep water rice?
Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which micronutrient is required for splitting of water molecule during photosynthesis?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Axile placentation is observed in
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The reaction centre in PS II has an absorption maxima at
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Unequivocal proof that DNA is the genetic material was first proposed by
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Among eukaryotes, replication of DNA takes place in -
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as -
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Cellulose does not form blue colour with Iodine because
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height. Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling. In the light of the above statements, choose the most appropriate answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Expressed Sequence Tags (ESTs) refers to
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the correct statements : A. Detritivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The thickness of ozone in a column of air in the atmosphere is measured in terms of :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following stages of meiosis involves division of centromere?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
How many ATP and NADPH₂ are required for the synthesis of one molecule of Glucose during Calvin cycle?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In the equation GPP − R = NPP GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is ________.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
What is the function of tassels in the corn cob?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the pair of heterosporous pteridophytes among the following :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II : Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following statements is NOT correct?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
How many different proteins does the ribosome consist of?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves. In the light of the above statements, choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following combinations is required for chemiosmosis?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the correct statements : A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues exterior to vascular cambium. D. Bark refers to periderm and secondary phloem. E. Phellogen is single-layered in thickness. Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell. B. Cutting of DNA at specific location by restriction enzyme. C. Isolation of desired DNA fragment. D. Amplification of gene of interest using PCR. Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements is correct?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following symbols represents mating between relatives in human pedigree analysis?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal) Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two subunits of β type). In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic Reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II with respect to human eye. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between the menarche and menopause. Choose the most appropriate answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Vital capacity of lung is ________.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R: Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following functions is carried out by cytoskeleton in a cell?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Nephrons are of two types: Cortical and Juxta medullary, based on their relative position in cortex and medulla. Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations. In the light of the above statements, choose the most appropriate answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Broad palm with single palm crease is visible in a person suffering from-
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Radial symmetry is NOT found in adults of phylum ______.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following is not a cloning vector?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart. E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The unique mammalian characteristics are:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of R.B.Cs formation Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In cockroach, excretion is brought about by- A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: During phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following is NOT an advantage of inbreeding?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs. B. Basophils secrete histamine, serotonin and heparin. C. Basophils are involved in inflammatory response. D. Basophils have kidney shaped nucleus. E. Basophils are agranulocytes. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following reactions will NOT give primary amine product?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List-I with List-II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic. Reason R : The deep blue solution is due to the formation of amide. In the light of above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe³⁺ because of the formation of -
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm⁻¹ cm⁻¹ and resistance of cell containing the solution at 25°C is 60 ohm. The value of cell constant is -
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A reaction can have zero activation energy. Reason R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy. In the light of above statements, choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one is an example of heterogenous catalysis?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The given compound is an example of ________.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the product in the following reaction:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Helium is used to dilute oxygen in diving apparatus. Reason R : Helium has high solubility in O₂. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is AₓBᵧ, then the value of x + y is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The relation between , ( = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Amongst the following, the total number of species NOT having eight electrons around central atom in its outermost shell, is , , , , :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The correct order of energies of molecular orbitals of molecule, is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include : A. dipole-dipole forces. B. dipole-induced dipole forces. C. hydrogen bonding. D. covalent bonding. E. dispersion forces. Choose the most appropriate answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements are NOT correct? A. Hydrogen is used to reduce heavy metal oxides to metals. B. Heavy water is used to study reaction mechanism. C. Hydrogen is used to make saturated fats from oils. D. The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element. E. Hydrogen reduces oxides of metals that are more active than iron. Choose the most appropriate answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which amongst the following molecules on polymerization produces neoprene?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The element expected to form largest ion to achieve the nearest noble gas configuration is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Select the correct statements from the following: A. Atoms of all elements are composed of two fundamental particles. B. The mass of the electron is 9.10939 × 10⁻³¹ kg. C. All the isotopes of a given element show same chemical properties. D. Protons and electrons are collectively known as nucleons. E. Dalton’s atomic theory regarded the atom as an ultimate particle of matter. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Consider the following reaction and identify the product (P).
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The stability of Cu²⁺ is more than Cu⁺ salts in aqueous solution due to:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Amongst the given options which of the following molecules / ion acts as a Lewis acid?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify product (A) in the following reaction:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Taking stability as the factor, which one of the following represents correct relationship?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Homoleptic complex from the following complexes is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Complete the following reaction: [C] is ________.Complete the following reaction: [C] is ________.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The right option for the mass of CO₂ produced by heating 20 g of 20% pure limestone is: (Atomic mass of Ca = 40)
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
For a certain reaction, the rate = k[A]²[B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : In equation ΔᵣG = −nFEcell, value of ΔᵣG depends on n. Reason R : Ecell is an intensive property and ΔᵣG is an extensive property. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List-I with List-II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements are INCORRECT? A. All the transition metals except scandium form MO oxides which are ionic. B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc₂O₃ to Mn₂O₇. C. Basic character increases from V₂O₃ to V₂O₄ to V₂O₅. D. V₂O₄ dissolves in acids to give VO₄³⁻ salts. E. CrO is basic but Cr₂O₃ is amphoteric. Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which complex compound is most stable?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Consider the following compounds/species: The number of compounds/species which obey Huckel's rule is ____.Consider the following compounds/species: The number of compounds/species which obey Huckel's rule is ____.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
What fraction of one edge centred octahedral void lies in one unit cell of fcc?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
On balancing the given redox reaction, a Cr₂O₇²⁻ + b SO₃²⁻(aq) + c H⁺(aq) → 2a Cr³⁺(aq) + b SO₄²⁻(aq) + c/2 H₂O(l) the coefficients a, b and c are found to be, respectively -
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The equilibrium concentrations of the species in the reaction A + B ⇌ C + D are 2, 3, 10 and 6 mol L⁻¹, respectively at 300 K. ΔG° for the reaction is (R = 2 cal/mol K)
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Pumice stone is an example of -
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the major product obtained in the following reaction:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the final product [D] obtained in the following sequence of reactions.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which amongst the following will be most readily dehydrated under acidic conditions?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Consider the following reaction: Consider the following reaction:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The equivalent capacitance of the system shown in the following circuit is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
If over a surface, then:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A 12 V, 60 W lamp is connected to the secondary of a step down transformer, whose primary is connected to mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Light travels a distance x in time in air and 10x in time in another denser medium. What is the critical angle for this medium?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) Ω. The colour of third band must be :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I : Photovoltaic devices can convert optical radiation into electrical energy. Statement II : Zener diode is designed to operate under reverse bias in breakdown region. In the light of the above statements, choose the most appropriate answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The magnetic energy stored in an inductor of inductance 4 μH carrying a current of 2 A is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The angular acceleration of a body, moving along the circumference of a circle, is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A Carnot engine has an efficiency of 50% when the source is at a temperature 327°C. The temperature of the sink is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be : (G = gravitational constant)
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A vehicle travels half the distance with speed v and the remaining distance with speed 2v. Its average speed is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly : (surface tension of soap solution = 0.03 )
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The half life of a radioactive substance is 20 minutes. In how much time, the activity of the substance drops to (1/16)th of its initial value?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency 2.0 × 10¹⁰ Hz and amplitude 48 V m⁻¹. Then the amplitude of oscillating magnetic field is : (Speed of light in free space = 3 × 10⁸ m s⁻¹)
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The temperature of a gas is -50° C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
An ac source is connected to a capacitor C. Due to decrease in its operating frequency :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
For Young’s double slit experiment, two statements are given below: Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant. Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the Brackett series is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 μF and resistance R is 100 Ω. The frequency at which resonance occurs is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The venturi-meter works on :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
An electric dipole is placed at an angle of with an electric field of intensity . It experiences a torque equal to . Calculate the magnitude of charge on the dipole, if the dipole length is .
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The magnitude and direction of the current in the following circuit is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The net magnetic flux through any closed surface is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A bullet is fired from a gun at the speed of 280 m s⁻¹ in the direction 30° above the horizontal. The maximum height attained by the bullet is : (g = 9.8 m s⁻², sin 30° = 0.5)
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Two thin lenses are of same focal lengths (f), but one is convex and the other is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The net impedance of circuit (as shown in figure) will be :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The x-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at t = 2 s is :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
An electric dipole is placed as shown in the figure. The electric potential (in 10² V) at point P due to the dipole is (ε₀ = permittivity of free space and 1/4π ε₀ = K) :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A bullet from a gun is fired on a rectangular wooden block with velocity . When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes . Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
For the following logic circuit, the truth table is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s⁻¹. The ball strikes the water surface after 4 s. The height of bridge above water surface is (Take g = 10 m s⁻²):
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those resistors are connected in parallel to the same battery, the current is increased n times. The value of n is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A wire carrying a current along the positive -axis has length . It is kept in a magnetic field . The magnitude of the magnetic force acting on the wire is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G the universal constant of gravitation, the quantity 3π/Gd represents:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s⁻²).
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The resistance of platinum wire at 0°C is 2Ω and 6.8Ω at 80°C. The temperature coefficient of resistance of the wire is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The radius of inner most orbit of hydrogen atom is 5.3 × 10⁻¹¹ m. What is the radius of third allowed orbit of hydrogen atom?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A very long conducting wire is bent in a semi-circular shape from A to B as shown in the figure. The magnetic field at point P for steady current configuration is given by:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which amongst the following options is correct graphical representation of Boyle’s Law?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Unlock All NEET 2023 Questions
200 questions · AI explanations · Progress tracking · Free forever