NEET · 2024

NEET 2024
Previous Year Questions

Complete NEET 2024 question paper — 200 questions across Physics, Chemistry and Biology with detailed solutions and AI explanations.

200

Total

50

Physics

50

Chemistry

100

Biology

Difficulty:200 questions

Previewing 10 questions free. Sign up to attempt all 200 NEET 2024 questions with AI explanations.

12024

In the given figure, which component has thin outer walls and highly thickened inner walls?

Medium NEET 2024Structural Organisation in AnimalsClass 11Plant Tissues
22024

List of endangered species was released by-

Easy NEET 2024Biodiversity and ConservationClass 12Conservation
32024

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called;

Easy NEET 2024Biodiversity and ConservationClass 12Conservation
42024

Which one of the following can be explained on the basis of Mendel’s Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the characters appear as such in F₂ generation. C. Factors occur in pairs in normal diploid plants. D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct option:

Medium NEET 2024Principles of Inheritance and VariationClass 12Mendelian Genetics
52024

The lactose present in the growth medium of bacteria is transported to the cell by the action of:

Easy NEET 2024Cell: The Unit of LifeClass 11Eukaryotic Cell
62024

Match List I with List II Choose the correct answer from the options below:

Medium NEET 2024Microbes in Human WelfareClass 12Microbes in Human Welfare
72024

The equation of Verhulst-Pearl logistic growth is dNdt=rN[K−NK]\frac{dN}{dt} = rN\left[\frac{K-N}{K}\right] From this equation, K indicates:

Medium NEET 2024Organisms and PopulationsClass 12Population Growth
82024

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;

Medium NEET 2024Molecular Basis of InheritanceClass 12Transcription
92024

Formation of interfascicular cambium from fully developed parenchyma cells is an example for

Easy NEET 2024Photosynthesis in Higher PlantsClass 11Growth and Development
102024

Match List I with List II Choose the correct answer from the options given below:

Medium NEET 2024The Living WorldClass 11Fungi
112024

What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism. B. It may get integrated into the genome of the recipient. C. It may multiply and be inherited along with the host DNA. D. The alien piece of DNA is not an integral part of chromosome. E. It shows ability to replicate. Choose the correct answer from the options given below:

Hard NEET 2024Biotechnology: Principles and ProcessesClass 12Recombinant DNA Technology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

122024

Match List I with List II Choose the correct answer from the options below:

Medium NEET 2024Cell: The Unit of LifeClass 11Cell Organelles

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

132024

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to ovary from the given figures (a) and (b)

Medium NEET 2024Human ReproductionClass 11Morphology of Flowering Plants

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

142024

Spindle fibers attach to kinetochores of chromosomes during

Easy NEET 2024Cell: The Unit of LifeClass 11Cell Division

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

152024

These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration Choose the correct option:

Medium NEET 2024Biodiversity and ConservationClass 12Conservation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

162024

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

Easy NEET 2024BiomoleculesClass 11Chemical Composition

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

172024

Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar. B. The flowers of waterlily are not pollinated by water. C. In most of water-pollinated species, the pollen grains are protected from wetting. D. Pollen grains of some hydrophytes are long and ribbon like. E. In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options below:

Hard NEET 2024Sexual Reproduction in Flowering PlantsClass 12Pollination

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

182024

The cofactor of the enzyme carboxypeptidase is:

Easy NEET 2024Body Fluids and CirculationClass 11Biomolecules and Enzymes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

192024

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

Medium NEET 2024BiomoleculesClass 11Enzymes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

202024

Which of the following is an example of actinomorphic flower?

Medium NEET 2024Structural Organisation in AnimalsClass 11Morphology of Flowering Plants

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

212024

Given below are two statements: Statement I : Chromosomes become gradually visible under light microscope during leptotene stage. Statement II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose the correct option from the options below:

Hard NEET 2024Human ReproductionClass 12Cell Division

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

222024

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

Easy NEET 2024Principles of Inheritance and VariationClass 12Mendelian Genetics

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

232024

Given below are two statements: Statement I : Parenchyma is living but collenchyma is dead tissue. Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2024Structural Organisation in AnimalsClass 11Plant Anatomy

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

242024

Given below are two statements: Statement I : Bt toxins are insect group specific and coded by a gene cry IAc. Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2024Microbes in Human WelfareClass 12Biocontrol

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

252024

Which one of the following is not a criterion for classification of fungi?

Easy NEET 2024The Living WorldClass 11Kingdom Fungi

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

262024

The capacity to generate a whole plant from any cell of the plant is called:

Easy NEET 2024Biotechnology: Principles and ProcessesClass 12Plant Tissue Culture

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

272024

Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO₂ D. ATP E. NADPH Choose the correct answer from the options given below:

Medium NEET 2024Photosynthesis in Higher PlantsClass 11Factors Affecting Photosynthesis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

282024

Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. B. Tropical environments are more seasonal. C. More solar energy is available in tropics. D. Constant environments promote niche specialization. E. Tropical environments are constant and predictable. Choose the correct answer from the options below:

Hard NEET 2024Biodiversity and ConservationClass 12Biodiversity

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

292024

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

Medium NEET 2024Sexual Reproduction in Flowering PlantsClass 12Post-Fertilisation Events

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

302024

How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?

Medium NEET 2024Photosynthesis in Higher PlantsClass 11Factors Affecting Photosynthesis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

312024

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

Easy NEET 2024Principles of Inheritance and VariationClass 12Mendelian Genetics

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

322024

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

Easy NEET 2024Biotechnology: Principles and ProcessesClass 12Tools of Biotechnology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

332024

Bulliform cells are responsible for

Medium NEET 2024Photosynthesis in Higher PlantsClass 11Plant Anatomy and Adaptations

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

342024

Match List I with List II Choose the correct answer from the options given below:

Medium NEET 2024Principles of Inheritance and VariationClass 12Genetic Terminology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

352024

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

Medium NEET 2024Plant Growth and DevelopmentClass 11Plant Growth Regulators

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

362024

Match List I with List II Choose the correct answer from the options given below:

Medium NEET 2024Human ReproductionClass 11Morphology of Flowering Plants

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

372024

The DNA present in chloroplast is:

Easy NEET 2024Cell: The Unit of LifeClass 11Cell Organelles

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

382024

Identify the correct description about the given figure:

Medium NEET 2024Sexual Reproduction in Flowering PlantsClass 12Pollination

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

392024

Match List I with List II Choose the correct answer from the options given below:

Hard NEET 2024Biodiversity and ConservationClass 12Biodiversity

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

402024

Given below are two statements: Statement I : In C₃ plants, some O₂ binds to RuBisCO, hence CO₂ fixation is decreased. Statement II : In C₄ plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. In the light of the above statements, choose the correct answer from the options given below:

Hard NEET 2024Photosynthesis in Higher PlantsClass 11Factors Affecting Photosynthesis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

412024

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

Medium NEET 2024Respiration in PlantsClass 11Aerobic Respiration

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

422024

Match List I with List II Choose the correct answer from the options given below:

Medium NEET 2024Cell: The Unit of LifeClass 11Cellular Respiration

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

432024

Which of the following are fused in somatic hybridization involving two varieties of plants?

Easy NEET 2024Biotechnology: Principles and ProcessesClass 12Somatic Hybridization

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

442024

Match List I with List II Choose the correct answer from the options given below:

Medium NEET 2024Body Fluids and CirculationClass 11Biomolecules and Enzymes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

452024

Match List I with List II Choose the correct answer from the options given below:

Medium NEET 2024Structural Organisation in AnimalsClass 11Morphology of Flowering Plants

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

462024

Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin. D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer from the options given below:

Hard NEET 2024The Living WorldClass 11Algae

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

472024

Match List I with List II Choose the correct answer from the options given below:

Hard NEET 2024Molecular Basis of InheritanceClass 12Genetic Discoveries

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

482024

Which of the following statement is correct regarding the process of replication in E.coli?

Medium NEET 2024Molecular Basis of InheritanceClass 12DNA Replication

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

492024

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus increasing the yield?

Easy NEET 2024Plant Growth and DevelopmentClass 11Plant Growth Regulators

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

502024

In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m−2) yr−1100x\,(kcal\ m^{-2})\,yr^{-1} what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

Hard NEET 2024EcosystemClass 12Productivity

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

512024

Match List I with List II : Choose the correct answer from the options given below:

Easy NEET 2024Principles of Inheritance and VariationClass 12Mendelian and Chromosomal Disorders

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

522024

Match List I with List II : Choose the correct answer from the options given below:

Medium NEET 2024Cell Cycle and Cell DivisionClass 11Meiosis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

532024

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

Easy NEET 2024Breathing and Exchange of GasesClass 11Gas Transport

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

542024

Match List I with List II : Choose the correct answer from the options given below:

Easy NEET 2024Human Health and DiseaseClass 12Pathogens and Diseases

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

552024

Match List I with List II : Choose the correct answer from the options given below:

Medium NEET 2024Breathing and Exchange of GasesClass 11Mechanism of Breathing

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

562024

Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE) Choose the most appropriate answer from the options given below:

Medium NEET 2024Human Health and DiseaseClass 12Immunity and Vaccines

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

572024

Given below are two statements : Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. Statement II : The proximal convoluted tubule is lined by simple cuboidal brush border epithelium and increases the surface area for reabsorption. In the light of the above statements, choose the correct answer from the options given below :

Medium NEET 2024Excretory Products and Their EliminationClass 11Urine Formation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

582024

Which of the following is not a steroid hormone?

Easy NEET 2024Chemical Coordination and IntegrationClass 11Hormones

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

592024

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements choose the correct answer from the options given below :

Medium NEET 2024Human ReproductionClass 12Menstrual Cycle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

602024

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below :

Medium NEET 2024EvolutionClass 12Human Evolution

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

612024

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

Easy NEET 2024Locomotion and MovementClass 11Types of Movement

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

622024

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2024Human Health and DiseaseClass 12Drug, Alcohol and Tobacco Abuse

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

632024

The “Ti plasmid” of Agrobacterium tumefaciens stands for

Easy NEET 2024Biotechnology: Principles and ProcessesClass 12Tools of Biotechnology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

642024

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Medium NEET 2024Molecular Basis of InheritanceClass 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

652024

Match List I with List II : Choose the correct answer from the options given below:

Medium NEET 2024The Living WorldClass 11Pisces Classification

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

662024

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2024Structural Organisation in AnimalsClass 11Joints

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

672024

The flippers of the Penguins and Dolphins are the example of the

Easy NEET 2024Principles of Inheritance and VariationClass 12Evolution and Convergent Evolution

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

682024

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2024Biotechnology: Principles and ProcessesClass 12Biotechnology Applications in Agriculture and Medicine

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

692024

Match List I with List II : Choose the correct answer from the options given below:

Medium NEET 2024Cell: The Unit of LifeClass 11Cell Organelles and Ultrastructure

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

702024

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby. Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby. In the light of the above statements, choose the most appropriate answer from the options given below:

Easy NEET 2024Human ReproductionClass 12Pregnancy, Parturition and Lactation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

712024

Which of the following is not a component of Fallopian tube?

Easy NEET 2024Human ReproductionClass 12Female Reproductive System

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

722024

Which of the following statements is incorrect?

Medium NEET 2024Biotechnology: Principles and ProcessesClass 12Recombinant DNA Process

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

732024

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2024Neural Control and CoordinationClass 11Central Nervous System

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

742024

Match List I with List II : Choose the correct answer from the options given below :

Easy NEET 2024BiomoleculesClass 11Enzymes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

752024

Which of the following is not a natural/traditional contraceptive method?

Easy NEET 2024Reproductive HealthClass 12Birth Control

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

762024

Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle B. Purkinje fibres C. AV node D. Bundle branches E. SA node Choose the correct sequence of pathway from the options given below :

Medium NEET 2024Body Fluids and CirculationClass 11Cardiac Cycle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

772024

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2024The Living WorldClass 11Animal Kingdom Classification

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

782024

Match List I with List II : Choose the correct answer from the options given below :

Easy NEET 2024Human Health and DiseaseClass 12Immunity and Vaccines

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

792024

Consider the following statements : A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates Choose the correct answer from the options given below :

Easy NEET 2024The Living WorldClass 11Animal Kingdom Classification

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

802024

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on :

Easy NEET 2024Structural Organisation in AnimalsClass 11Cockroach Morphology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

812024

Given below are two statements : Statement I : The presence or absence of hymen is not a reliable indicator of virginity. Statement II : The hymen is torn during the first coitus only. In the light of the above statements, choose the correct answer from the options given below :

Easy NEET 2024Reproductive HealthClass 12Reproductive Health

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

822024

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

Medium NEET 2024EvolutionClass 12Hardy-Weinberg Principle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

832024

The following diagram showing restriction sites in E.coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:

Medium NEET 2024Biotechnology: Principles and ProcessesClass 12Recombinant DNA Technology

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

842024

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2024Reproductive HealthClass 12Birth Control

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

852024

Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below :

Medium NEET 2024Cell Cycle and Cell DivisionClass 11Cell Cycle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

862024

Choose the correct statement given below regarding juxta medullary nephron.

Medium NEET 2024Excretory Products and Their EliminationClass 11Human Excretory System

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

872024

The following are the statements about non-chordates : A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent. Choose the most appropriate answer from the options given below :

Medium NEET 2024The Living WorldClass 11Non-Chordates and Chordates

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

882024

Given below are two statements : Statement I : Mitochondria and chloroplasts are both double membrane bound organelles. Statement II : Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast. In the light of the above statements, choose the most appropriate answer from the options given below :

Medium NEET 2024Cell: The Unit of LifeClass 11Cell Organelles

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

892024

Regarding catalytic cycle of an enzyme action, select the correct sequential steps : A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds of the substrate broken. E. Substrate binding to active site. Choose the correct answer from the options given below :

Hard NEET 2024BiomoleculesClass 11Enzymes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

902024

Match List I with List II : List I A. P wave B. QRS complex C. T wave D. T-P gap List II I. Heart muscles are electrically silent. II. Depolarisation of ventricles. III. Depolarisation of atria. IV. Repolarisation of ventricles. Choose the correct answer from the options given below :

Medium NEET 2024Body Fluids and CirculationClass 11Cardiac Cycle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

912024

Given below are two statements : Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. Statement II : Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes. In the light of the above statements choose the most appropriate answer from the options given below :

Medium NEET 2024Human Health and DiseaseClass 12Immunity and Vaccines

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

922024

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2024Structural Organisation in AnimalsClass 11Animal Tissues and Glandular Epithelium

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

932024

Given below are two statements : Statement I : The cerebral hemispheres are connected by nerve tract known as corpus callosum. Statement II : The brain stem consists of the medulla oblongata, pons and cerebrum. In the light of the above statements, choose the most appropriate answer from the options given below :

Easy NEET 2024Neural Control and CoordinationClass 11Central Nervous System

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

942024

Match List I with List II : Choose the correct answer from the options given below :

Hard NEET 2024Molecular Basis of InheritanceClass 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

952024

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2024Principles of Inheritance and VariationClass 12Geological Time Scale and Evolution

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

962024

Given below are two statements : Statement I : Gause’s competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely. Statement II : According to Gause’s principle, during competition, the inferior will be eliminated. This may be true if resources are limiting. In the light of the above statements, choose the correct answer from the options given below :

Medium NEET 2024EcosystemClass 12Gause’s Competitive Exclusion Principle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

972024

Match List I with List II : Choose the correct answer from the options given below :

Medium NEET 2024Chemical Coordination and IntegrationClass 11Endocrine Disorders

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

982024

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

Medium NEET 2024Human ReproductionClass 12Fertilisation and Implantation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

992024

As per ABO blood grouping system, the blood group of father is B+^+, mother is A+^+ and child is O+^+. Their respective genotype can be Choose the most appropriate answer from the options given below :

Hard NEET 2024Principles of Inheritance and VariationClass 12ABO Blood Group Inheritance

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1002024

Match List I with List II related to digestive system of cockroach. Choose the correct answer from the options given below :

Medium NEET 2024Structural Organisation in AnimalsClass 11Digestive System of Cockroach

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1012024

Match List I with List II. Choose the correct answer from the options given below:

Easy NEET 2024ThermodynamicsClass 11Thermodynamic Terms & Processes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1022024

Given below are two statements: Statement I : The boiling point of three isomeric pentanes follows the order n-pentane > isopentane > neopentane Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point. In the light of the above statements, choose the most appropriate answer from the options given below:

Medium NEET 2024HydrocarbonsClass 11Boiling Point and Branching

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1032024

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2024Chemical Bonding and Molecular StructureClass 11Ionic & Covalent Bonding

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1042024

Which one of the following alcohols reacts instantaneously with Lucas reagent?Which one of the following alcohols reacts instantaneously with Lucas reagent?

Medium NEET 2024Alcohols, Phenols and EthersClass 12Alcohols

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1052024

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2024Structure of AtomClass 11Atomic Orbitals & Quantum Numbers

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1062024

‘Spin only’ magnetic moment is same for which of the following ions? A. Ti3+\mathrm{Ti^{3+}} B. Cr2+\mathrm{Cr^{2+}} C. Mn2+\mathrm{Mn^{2+}} D. Fe2+\mathrm{Fe^{2+}} E. Sc3+\mathrm{Sc^{3+}} Choose the most appropriate answer from the options given below:

Medium NEET 2024The d- and f-Block ElementsClass 12General Properties

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1072024

On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as:

Easy NEET 2024Organic Chemistry: Some Basic Principles and TechniquesClass 11Purification Techniques

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1082024

The energy of an electron in the ground state (n=1)(n=1) for He+\mathrm{He^+} ion is −x J-x\,J, then that for an electron in n=2n=2 state for Be3+\mathrm{Be^{3+}} ion in J is:

Medium NEET 2024Structure of AtomClass 11Bohr Model of Atom

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1092024

Activation energy of any chemical reaction can be calculated if one knows the value of:

Easy NEET 2024Chemical KineticsClass 12Arrhenius Equation & Collision Theory

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1102024

Which plot of ln⁡k\ln k vs 1T\dfrac{1}{T} is consistent with Arrhenius equation?

Easy NEET 2024Chemical KineticsClass 12Arrhenius Equation & Collision Theory

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1112024

Given below are two statements: Statement I : The boiling point of hydrides of Group 16 elements follows the order H₂O > H₂Te > H₂Se > H₂S. Statement II : On the basis of molecular mass, H₂O is expected to have lower boiling point than the other members of the group but due to presence of extensive H-bonding in H₂O, it has higher boiling point. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2024The d- and f-Block ElementsClass 12Hydrides of Group 16 Elements

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1122024

The reagents with which glucose does not give the corresponding tests/products are: A. Tollen’s reagent B. Schiff’s reagent C. HCN D. NH₂OH E. NaHSO₃ Choose the correct options from the given below:

Medium NEET 2024BiomoleculesClass 12Carbohydrates

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1132024

Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N

Medium NEET 2024Classification of Elements and Periodicity in PropertiesClass 11Periodic Trends

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1142024

Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si

Easy NEET 2024Classification of Elements and Periodicity in PropertiesClass 11Periodic Trends

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1152024

The E° value for the Mn³⁺/Mn²⁺ couple is more positive than that of Cr³⁺/Cr²⁺ or Fe³⁺/Fe²⁺ due to change of:

Hard NEET 2024The d- and f-Block ElementsClass 12Standard Electrode Potential

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1162024

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2024Coordination CompoundsClass 12Shapes of Coordination Compounds

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1172024

Match List I with List II. Choose the correct answer from the options given below:

Hard NEET 2024Coordination CompoundsClass 12Isomerism

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1182024

Intramolecular hydrogen bonding is present in:

Medium NEET 2024Alcohols, Phenols and EthersClass 12Alcohols

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1192024

Given below are two statements: Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II : Aniline cannot be prepared through Gabriel synthesis. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2024AminesClass 12Preparation Methods

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1202024

The highest number of helium atoms is in:

Easy NEET 2024Some Basic Concepts of ChemistryClass 11Mole Concept & Molar Mass

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1212024

Match List I with List II.

Hard NEET 2024Organic Chemistry: Some Basic Principles and TechniquesClass 11Organic Reactions and Reagents

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1222024

Identify the correct reagents that would bring about the following transformation.

Hard NEET 2024HydrocarbonsClass 11Hydroboration Oxidation and Oxidation of Alcohols

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1232024

The compound that will undergo Sₙ1 reaction with the fastest rate is:

Medium NEET 2024Haloalkanes and HaloarenesClass 12Chemical Reactions & Mechanisms

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1242024

Fehling’s solution ‘A’ is:

Easy NEET 2024Aldehydes, Ketones and Carboxylic AcidsClass 12Important Reactions & Uses

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1252024

The most stable carbocation among the following is:

Medium NEET 2024Organic Chemistry: Some Basic Principles and TechniquesClass 11Electronic Effects & Reaction Mechanisms

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1262024

For the reaction: 2A⇌B+C2A \rightleftharpoons B + C Kc=4×10−3K_c = 4\times10^{-3} At a given time, the composition of reaction mixture is: [A]=[B]=[C]=2×10−3 M[A]=[B]=[C]=2\times10^{-3}\,M Then, which of the following is correct?

Medium NEET 2024EquilibriumClass 11Equilibrium Constant & Le Chatelier Principle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1272024

The Henry’s law constant (KH_H) values of three gases A, B, C in water are 145, 2×10⁻⁵ and 35 kbar respectively. The solubility of these gases in water follows:

Easy NEET 2024SolutionsClass 12Solubility & Vapour Pressure

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1282024

A compound with a molecular formula of C₆H₁₄ has two tertiary carbons. Its IUPAC name is:

Easy NEET 2024HydrocarbonsClass 11Alkanes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1292024

In which of the following equilibria, Kₚ and Kc_c are NOT equal?

Medium NEET 2024EquilibriumClass 11Equilibrium Constant & Le Chatelier Principle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1302024

Which reaction is NOT a redox reaction?

Easy NEET 2024Redox ReactionsClass 11Oxidation & Reduction Concepts

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1312024

Given below are two statements: Statement I : Both [Co(NH₃)₆]³⁺ and [CoF₆]³⁻ complexes are octahedral but differ in their magnetic behaviour. Statement II : [Co(NH₃)₆]³⁺ is diamagnetic whereas [CoF₆]³⁻ is paramagnetic. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2024Coordination CompoundsClass 12Bonding & Crystal Field Theory

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1322024

1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to:

Medium NEET 2024Some Basic Concepts of ChemistryClass 11Percentage Composition & Stoichiometry

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1332024

Among Group 16 elements, which one does NOT show −2 oxidation state?

Easy NEET 2024The d- and f-Block ElementsClass 12Oxidation States of Group 16 Elements

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1342024

In which of the following processes entropy increases? A. A liquid evaporates to vapour. B. Temperature of a crystalline solid lowered from 130 K to 0 K. C. 2 NaHCO₃(s) → Na₂CO₃(s) + CO₂(g) + H₂O(g) D. Cl₂(g) → 2 Cl(g) Choose the correct answer from the options given below:

Medium NEET 2024ThermodynamicsClass 11Entropy

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1352024

Match List I with List II. Choose the correct answer from the options given below:

Hard NEET 2024ElectrochemistryClass 12Electrolysis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1362024

Major products A and B formed in the following reaction sequence are:

Medium NEET 2024Alcohols, Phenols and EthersClass 12Alcohols

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1372024

Consider the following reaction in a sealed vessel at equilibrium with concentrations of: N2=3.0×10−3 M,O2=4.2×10−3 MN_2=3.0\times10^{-3}\,M,\quad O_2=4.2\times10^{-3}\,M and NO=2.8×10−3 MNO=2.8\times10^{-3}\,M 2NO(g)⇌N2(g)+O2(g)2NO_{(g)} \rightleftharpoons N_2{}_{(g)}+O_2{}_{(g)} If 0.1 mol L−10.1\,\text{mol L}^{-1} of NO(g)NO_{(g)} is taken in a closed vessel, what will be the degree of dissociation (α)(\alpha) of NO(g)NO_{(g)} at equilibrium?

Hard NEET 2024EquilibriumClass 11Equilibrium Constant & Le Chatelier Principle

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1382024

The products A and B obtained in the following reactions, respectively, are: 3ROH + PCl₃ → 3RCl + A ROH + PCl₅ → RCl + HCl + B

Medium NEET 2024The d- and f-Block ElementsClass 12Phosphorus Halides

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1392024

Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI. A. Al³⁺ B. Cu²⁺ C. Ba²⁺ D. Co²⁺ E. Mg²⁺ Choose the options from the given below:

Medium NEET 2024S-Block ElementsClass 11Qualitative Analysis of Cations

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1402024

During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following is added to prevent hydrolysis of Fe²⁺ ion?

Easy NEET 2024HydrogenClass 11Mohr's Salt

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1412024

The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is: (Given: R = 2 cal K⁻¹ mol⁻¹)

Medium NEET 2024ThermodynamicsClass 11Thermodynamic Terms & Processes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1422024

For the given reaction:

Medium NEET 2024HydrocarbonsClass 11Alkenes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1432024

The plot of osmotic pressure (Π) vs concentration (mol L⁻¹) for a solution gives a straight line with slope 25.73 L bar mol⁻¹. The temperature at which the osmotic pressure measurement is done is: (Use R = 0.083 L bar mol⁻¹ K⁻¹)

Medium NEET 2024SolutionsClass 12Colligative Properties

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1442024

Identify the major product C formed in the following reaction sequence:

Hard NEET 2024AminesClass 12Preparation Methods

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1452024

A compound X contains 32% of A, 20% of B and remaining percentage of C. The empirical formula of X is: (Given atomic masses of A = 64 u, B = 40 u, C = 32 u)

Medium NEET 2024Some Basic Concepts of ChemistryClass 11Percentage Composition & Stoichiometry

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1462024

The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of activation. Given R = 8.314 J K⁻¹ mol⁻¹, log 4 = 0.6021

Hard NEET 2024Chemical KineticsClass 12Arrhenius Equation & Collision Theory

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1472024

Identify the correct answer.

Medium NEET 2024Chemical Bonding and Molecular StructureClass 11Dipole Moment and Resonance

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1482024

The pair of lanthanoid ions which are diamagnetic is:

Hard NEET 2024The d- and f-Block ElementsClass 12Lanthanoid Ions and Magnetic Properties

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1492024

Given below are two statements: Statement I : [Co(NH₃)₆]³⁺ is a homoleptic complex whereas [Co(NH₃)₄Cl₂]⁺ is a heteroleptic complex. Statement II : Complex [Co(NH₃)₆]³⁺ has only one kind of ligands but [Co(NH₃)₄Cl₂]⁺ has more than one kind of ligands. In the light of the above statements, choose the correct answer from the options given below:

Easy NEET 2024Coordination CompoundsClass 12Homoleptic and Heteroleptic Complexes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1502024

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 1000 seconds is: (Given : Molar mass of Cu : 63 g mol⁻¹, 1F = 96487 C)

Medium NEET 2024ElectrochemistryClass 12Electrolysis

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1512024

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is v in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)?

Easy NEET 2024System of Particles and Rotational MotionClass 11Rotational Dynamics

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1522024

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively are through the directions:

Medium NEET 2024Electromagnetic InductionClass 12Lenz's Law

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1532024

Consider the following statements A and B and identify the correct answer: A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph. B. In a reverse biased pn junction diode, the current measured in (μA), is due to majority charge carriers.

Medium NEET 2024Semiconductor ElectronicsClass 12Diodes & Rectifiers

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1542024

A wire of length 'l' and resistance 100 Ω is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

Medium NEET 2024Current ElectricityClass 12Ohm's Law & Resistivity

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1552024

In the following circuit, the equivalent capacitance between terminal A and terminal B is:

Medium NEET 2024Electrostatic Potential and CapacitanceClass 12Capacitors & Capacitance

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1562024

The output (Y)(Y) of the given logic gate is similar to the output of an/a:

Easy NEET 2024Semiconductor ElectronicsClass 12Logic Gates & Electronic Devices

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1572024

The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 Ω, when connected through an external resistance of 4 Ω as shown in the figure is:

Easy NEET 2024Current ElectricityClass 12Cells & Internal Resistance

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1582024

The mass of a planet is 1/10th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:

Easy NEET 2024GravitationClass 11Acceleration Due to Gravity

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1592024

In a uniform magnetic field of 0.049 T0.049\,\text{T}, a magnetic needle performs 2020 complete oscillations in 5 s5\,\text{s} as shown. The moment of inertia of the needle is 9.8×10−6 kg m29.8\times10^{-6}\,\text{kg m}^2. If the magnetic moment of the needle is x×10−5 A m2x\times10^{-5}\,\text{A m}^2, then the value of xx is:

Medium NEET 2024Moving Charges and MagnetismClass 12Magnetic dipole; Oscillations of a magnetic needle in uniform magnetic field

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1602024

If c is the velocity of light in free space, the correct statements about photon among the following are: A. The energy of a photon is E = hν. B. The velocity of a photon is c. C. The momentum of a photon, p = (hv/c). D. In a photon-electron collision, both total energy and total momentum are conserved. E. Photon possesses positive charge.

Medium NEET 2024Dual Nature of Radiation and MatterClass 12Photon Theory

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1612024

The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young modulus, respectively, are 8 × 10⁸ N m⁻² and 2 × 10¹¹ N m⁻², is:

Medium NEET 2024Mechanical Properties of SolidsClass 11Hooke's Law & Elastic Moduli

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1622024

A logic circuit provides the output Y as per the following truth table. The expression for the output Y is:ABY001010101110

Medium NEET 2024Semiconductor ElectronicsClass 12Logic Gates & Electronic Devices

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1632024

The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is 2400 g cm22400\,\text{g cm}^2. The length of the 400 g400\,\text{g} rod is nearly:

Easy NEET 2024System of Particles and Rotational MotionClass 11Moment of Inertia

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1642024

In a vernier calipers, (N+1)(N+1) divisions of vernier scale coincide with NN divisions of main scale. If 1 MSD1\,\text{MSD} represents 0.1 mm0.1\,\text{mm}, the vernier constant (in cm) is:

Medium NEET 2024Units and MeasurementsClass 11Errors in Measurement

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1652024

Match List I with List II. Choose the correct answer from the options given below:

Medium NEET 2024AtomsClass 12Hydrogen Spectrum

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1662024

If the monochromatic source in Young’s double slit experiment is replaced by white light, then

Easy NEET 2024Wave OpticsClass 12Interference

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1672024

The graph which shows the variation of (1/λ²) and its kinetic energy, E is (where λ is de Broglie wavelength of a free particle):

Medium NEET 2024Dual Nature of Radiation and MatterClass 12Matter Waves

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1682024

Match List-I with List-II. Choose the correct answer from the options given below:

Medium NEET 2024Magnetism and MatterClass 12Magnetic Properties of Materials

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1692024

An unpolarised light beam strikes a glass surface at Brewster’s angle. Then:

Medium NEET 2024Wave OpticsClass 12Polarisation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1702024

A particle moving with uniform speed in a circular path maintains:

Easy NEET 2024Motion in a PlaneClass 11Uniform Circular Motion

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1712024

The quantities which have the same dimensions as those of solid angle are:

Medium NEET 2024Units and MeasurementsClass 11Dimensions & Dimensional Formulae

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1722024

A bob is whirled in a horizontal plane by means of a string with an initial speed of ω rpm. The tension in the string is T. If speed becomes 2ω while keeping the same radius, the tension in the string becomes:

Easy NEET 2024Laws of MotionClass 11Circular Motion Applications

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1732024

If 𝑥 = 5 sin(πt + π/3) m represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are:

Easy NEET 2024OscillationsClass 11Simple Harmonic Motion

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1742024

A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:

Medium NEET 2024ThermodynamicsClass 11Thermodynamic Processes

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1752024

Given below are two statements: Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges. Statement II: Atoms of each element are stable and emit their characteristic spectrum. In the light of the above statements, choose the most appropriate answer from the options given below:

Easy NEET 2024AtomsClass 12Atomic Spectra

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1762024

In an ideal transformer, the turns ratio is Np_p/Ns_s = 1/2. The ratio Vs_s : Vp_p is equal to (the symbols carry their usual meaning):

Easy NEET 2024Alternating CurrentClass 12Transformers

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1772024

Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with velocity v₁ while body B is at rest before collision. The velocity of the system after collision is v₂. The ratio v₁ : v₂ is:

Medium NEET 2024Laws of MotionClass 11Momentum & Impulse

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1782024

In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are:

Medium NEET 2024NucleiClass 12Radioactivity

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1792024

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: The potential VV at any axial point, at 2 m2\,m distance (r)(r) from the centre of the dipole of dipole moment vector P⃗\vec{P} of magnitude 4×10−6 C m4\times10^{-6}\,C\,m, is ±9×103 V\pm 9\times10^{3}\,V. (Take: 14πε0=9×109  SI units)\frac{1}{4\pi\varepsilon_0}=9\times10^9\;\text{SI units)} Reason R: V=±2P4πε0r2V = \pm \frac{2P}{4\pi\varepsilon_0 r^2} where r is the distance of any axial point situated at 2 m from the centre of the dipole. In the light of the above statements, choose the correct answer from the options given below:

Easy NEET 2024Electric Charges and FieldsClass 12Electric Dipole

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1802024

A thin spherical shell is charged by some source. The potential difference between two points C and P (in V) shown in the figure is: (Take 1/(4πϵ₀) = 9 × 10⁹ SI units)

Medium NEET 2024Electrostatic Potential and CapacitanceClass 12Electrostatic Potential

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1812024

A thin flat circular disc of radius 4.5 cm4.5\,\text{cm} is placed gently over the surface of water. If surface tension of water is 0.07 N m−10.07\,\text{N m}^{-1}, then the excess force required to take it away from the surface is:

Medium NEET 2024Mechanical Properties of FluidsClass 11Surface Tension and Excess Force

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1822024

A light ray enters through a right angled prism at point P with the angle of incidence 30° as shown in figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the prism is:

Hard NEET 2024Ray Optics and Optical InstrumentsClass 12Prism

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1832024

At any instant of time t, the displacement of any particle is given by 2t − 1 (SI unit) under the influence of force of 5 N. The value of instantaneous power (in SI unit) is:

Easy NEET 2024Work, Energy and PowerClass 11Spring Potential Energy & Power

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1842024

A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as 4π × 10⁻⁷ SI units):

Easy NEET 2024Moving Charges and MagnetismClass 12Biot-Savart Law

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1852024

A horizontal force 10 N is applied to a block A as shown in figure. The mass of blocks A and B are 2 kg and 3 kg, respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is:

Medium NEET 2024Laws of MotionClass 11Force, Inertia & Newton's Laws

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1862024

A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distant object is:

Easy NEET 2024Ray Optics and Optical InstrumentsClass 12Optical Instruments

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1872024

Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

Medium NEET 2024Current ElectricityClass 12Electrical Energy & Power

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1882024

If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is 𝑥/2 times its original time period. Then the value of 𝑥 is:

Medium NEET 2024OscillationsClass 11Simple Pendulum

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1892024

A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates:

Easy NEET 2024Current ElectricityClass 12Displacement Current

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1902024

A metallic bar of Young’s modulus 0.5 × 10¹¹ N m⁻² and coefficient of linear expansion 10⁻⁵ °C⁻¹, length 1 m and area of cross-section 10⁻³ m² is heated from 0°C to 100°C without expansion or bending. The compressive force developed in it is:

Medium NEET 2024Mechanical Properties of SolidsClass 11Thermal Expansion and Stress

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1912024

The velocity (v) – time (t) plot of the motion of a body is shown below. The acceleration (a) – time (t) graph that best suits this motion is:

Medium NEET 2024Motion in a Straight LineClass 11Motion Graphs

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1922024

The following graph represents the T-V curves of an ideal gas (where T is the temperature and V the volume) at three pressures P₁, P₂ and P₃ compared with those of Charles’s law represented by dotted lines. Then the correct relation is:

Medium NEET 2024ThermodynamicsClass 11Charles Law

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1932024

A 10 μF capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is nearly (Take π = 3.14):

Medium NEET 2024Alternating CurrentClass 12AC in Resistor, Inductor & Capacitor

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1942024

Choose the correct circuit which can achieve the bridge balance.

Hard NEET 2024Current ElectricityClass 12Wheatstone & Metre Bridge

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1952024

The property which is not of an electromagnetic wave travelling in free space is that:

Easy NEET 2024Electromagnetic WavesClass 12Electromagnetic Waves

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1962024

The minimum energy required to launch a satellite of mass mm from the surface of earth of mass MM and radius RR in a circular orbit at an altitude of 2R2R from the surface of the earth is:

Hard NEET 2024GravitationClass 11Satellites & Orbital Motion

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1972024

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then: A. the charge stored in it, increases. B. the energy stored in it, decreases. C. its capacitance increases. D. the ratio of charge to its potential remains the same. E. the product of charge and voltage increases. Choose the most appropriate answer from the options given below:

Medium NEET 2024Electrostatic Potential and CapacitanceClass 12Capacitors & Capacitance

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1982024

A force defined by F = αt² + βt acts on a particle at a given time t. The factor which is dimensionless, if α and β are constants, is:

Hard NEET 2024Units and MeasurementsClass 11Dimensional Analysis & Applications

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

1992024

A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to: A. hold the sheet there if it is magnetic. B. hold the sheet there if it is non-magnetic. C. move the sheet away from the pole with uniform velocity if it is conducting. D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar. Choose the correct statement(s) from the options given below:

Medium NEET 2024Magnetism and MatterClass 12Magnetic Properties of Materials

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

2002024

An iron bar of length LL has magnetic moment MM. It is bent at the middle of its length such that the two arms make an angle 60∘60^\circ with each other. The magnetic moment of this new magnet is:

Medium NEET 2024Moving Charges and MagnetismClass 12Magnetic Dipole & Torque

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

Unlock All NEET 2024 Questions

200 questions · AI explanations · Progress tracking · Free forever