NEET 2024
Previous Year Questions

In the given figure, which component has thin outer walls and highly thickened inner walls?

List of endangered species was released by-

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called;

Which one of the following can be explained on the basis of Mendel’s Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the characters appear as such in F₂ generation. C. Factors occur in pairs in normal diploid plants. D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct option:

The lactose present in the growth medium of bacteria is transported to the cell by the action of:

Match List I with List II Choose the correct answer from the options below:

The equation of Verhulst-Pearl logistic growth is $\frac{dN}{dt} = rN\left[\frac{K-N}{K}\right]$ From this equation, K indicates:

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;

Formation of interfascicular cambium from fully developed parenchyma cells is an example for

Match List I with List II Choose the correct answer from the options given below:

What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism. B. It may get integrated into the genome of the recipient. C. It may multiply and be inherited along with the host DNA. D. The alien piece of DNA is not an integral part of chromosome. E. It shows ability to replicate. Choose the correct answer from the options given below:

Match List I with List II Choose the correct answer from the options below:

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to ovary from the given figures (a) and (b)

Spindle fibers attach to kinetochores of chromosomes during

These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration Choose the correct option:

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar. B. The flowers of waterlily are not pollinated by water. C. In most of water-pollinated species, the pollen grains are protected from wetting. D. Pollen grains of some hydrophytes are long and ribbon like. E. In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options below:

The cofactor of the enzyme carboxypeptidase is:

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

Which of the following is an example of actinomorphic flower?

Given below are two statements: Statement I : Chromosomes become gradually visible under light microscope during leptotene stage. Statement II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose the correct option from the options below:

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

Given below are two statements: Statement I : Parenchyma is living but collenchyma is dead tissue. Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I : Bt toxins are insect group specific and coded by a gene cry IAc. Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut. In the light of the above statements, choose the correct answer from the options given below:

Which one of the following is not a criterion for classification of fungi?

The capacity to generate a whole plant from any cell of the plant is called:

Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO₂ D. ATP E. NADPH Choose the correct answer from the options given below:

Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. B. Tropical environments are more seasonal. C. More solar energy is available in tropics. D. Constant environments promote niche specialization. E. Tropical environments are constant and predictable. Choose the correct answer from the options below:

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

Bulliform cells are responsible for

Match List I with List II Choose the correct answer from the options given below:

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

Match List I with List II Choose the correct answer from the options given below:

The DNA present in chloroplast is:

Identify the correct description about the given figure:

Match List I with List II Choose the correct answer from the options given below:

Given below are two statements: Statement I : In C₃ plants, some O₂ binds to RuBisCO, hence CO₂ fixation is decreased. Statement II : In C₄ plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. In the light of the above statements, choose the correct answer from the options given below:

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

Match List I with List II Choose the correct answer from the options given below:

Which of the following are fused in somatic hybridization involving two varieties of plants?

Match List I with List II Choose the correct answer from the options given below:

Match List I with List II Choose the correct answer from the options given below:

Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin. D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer from the options given below:

Match List I with List II Choose the correct answer from the options given below:

Which of the following statement is correct regarding the process of replication in E.coli?

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus increasing the yield?

In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is $100x\,(kcal\ m^{-2})\,yr^{-1}$ what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

Match List I with List II : Choose the correct answer from the options given below:

Match List I with List II : Choose the correct answer from the options given below:

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

Match List I with List II : Choose the correct answer from the options given below:

Match List I with List II : Choose the correct answer from the options given below:

Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE) Choose the most appropriate answer from the options given below:

Given below are two statements : Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. Statement II : The proximal convoluted tubule is lined by simple cuboidal brush border epithelium and increases the surface area for reabsorption. In the light of the above statements, choose the correct answer from the options given below :

Which of the following is not a steroid hormone?

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements choose the correct answer from the options given below :

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below :

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

Match List I with List II : Choose the correct answer from the options given below :

The “Ti plasmid” of Agrobacterium tumefaciens stands for

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Match List I with List II : Choose the correct answer from the options given below:

Match List I with List II : Choose the correct answer from the options given below :

The flippers of the Penguins and Dolphins are the example of the

Match List I with List II : Choose the correct answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below:

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby. Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby. In the light of the above statements, choose the most appropriate answer from the options given below:

Which of the following is not a component of Fallopian tube?

Which of the following statements is incorrect?

Match List I with List II : Choose the correct answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below :

Which of the following is not a natural/traditional contraceptive method?

Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle B. Purkinje fibres C. AV node D. Bundle branches E. SA node Choose the correct sequence of pathway from the options given below :

Match List I with List II : Choose the correct answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below :

Consider the following statements : A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates Choose the correct answer from the options given below :

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on :

Given below are two statements : Statement I : The presence or absence of hymen is not a reliable indicator of virginity. Statement II : The hymen is torn during the first coitus only. In the light of the above statements, choose the correct answer from the options given below :

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

The following diagram showing restriction sites in E.coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:

Match List I with List II : Choose the correct answer from the options given below :

Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below :

Choose the correct statement given below regarding juxta medullary nephron.

The following are the statements about non-chordates : A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent. Choose the most appropriate answer from the options given below :

Given below are two statements : Statement I : Mitochondria and chloroplasts are both double membrane bound organelles. Statement II : Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast. In the light of the above statements, choose the most appropriate answer from the options given below :

Regarding catalytic cycle of an enzyme action, select the correct sequential steps : A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds of the substrate broken. E. Substrate binding to active site. Choose the correct answer from the options given below :

Match List I with List II : List I A. P wave B. QRS complex C. T wave D. T-P gap List II I. Heart muscles are electrically silent. II. Depolarisation of ventricles. III. Depolarisation of atria. IV. Repolarisation of ventricles. Choose the correct answer from the options given below :

Given below are two statements : Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. Statement II : Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes. In the light of the above statements choose the most appropriate answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below :

Given below are two statements : Statement I : The cerebral hemispheres are connected by nerve tract known as corpus callosum. Statement II : The brain stem consists of the medulla oblongata, pons and cerebrum. In the light of the above statements, choose the most appropriate answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below :

Given below are two statements : Statement I : Gause’s competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely. Statement II : According to Gause’s principle, during competition, the inferior will be eliminated. This may be true if resources are limiting. In the light of the above statements, choose the correct answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below :

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

As per ABO blood grouping system, the blood group of father is B$^+$, mother is A$^+$ and child is O$^+$. Their respective genotype can be Choose the most appropriate answer from the options given below :

Match List I with List II related to digestive system of cockroach. Choose the correct answer from the options given below :

Match List I with List II. Choose the correct answer from the options given below:

Given below are two statements: Statement I : The boiling point of three isomeric pentanes follows the order n-pentane > isopentane > neopentane Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point. In the light of the above statements, choose the most appropriate answer from the options given below:

Match List I with List II. Choose the correct answer from the options given below:

Which one of the following alcohols reacts instantaneously with Lucas reagent?Which one of the following alcohols reacts instantaneously with Lucas reagent?

Match List I with List II. Choose the correct answer from the options given below:

‘Spin only’ magnetic moment is same for which of the following ions? A. $\mathrm{Ti^{3+}}$ B. $\mathrm{Cr^{2+}}$ C. $\mathrm{Mn^{2+}}$ D. $\mathrm{Fe^{2+}}$ E. $\mathrm{Sc^{3+}}$ Choose the most appropriate answer from the options given below:

On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as:

The energy of an electron in the ground state $(n=1)$ for $\mathrm{He^+}$ ion is $-x\,J$, then that for an electron in $n=2$ state for $\mathrm{Be^{3+}}$ ion in J is:

Activation energy of any chemical reaction can be calculated if one knows the value of:

Which plot of $\ln k$ vs $\dfrac{1}{T}$ is consistent with Arrhenius equation?

Given below are two statements: Statement I : The boiling point of hydrides of Group 16 elements follows the order H₂O > H₂Te > H₂Se > H₂S. Statement II : On the basis of molecular mass, H₂O is expected to have lower boiling point than the other members of the group but due to presence of extensive H-bonding in H₂O, it has higher boiling point. In the light of the above statements, choose the correct answer from the options given below:

The reagents with which glucose does not give the corresponding tests/products are: A. Tollen’s reagent B. Schiff’s reagent C. HCN D. NH₂OH E. NaHSO₃ Choose the correct options from the given below:

Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N

Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si

The E° value for the Mn³⁺/Mn²⁺ couple is more positive than that of Cr³⁺/Cr²⁺ or Fe³⁺/Fe²⁺ due to change of:

Match List I with List II. Choose the correct answer from the options given below:

Match List I with List II. Choose the correct answer from the options given below:

Intramolecular hydrogen bonding is present in:

Given below are two statements: Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II : Aniline cannot be prepared through Gabriel synthesis. In the light of the above statements, choose the correct answer from the options given below:

The highest number of helium atoms is in:

Match List I with List II.

Identify the correct reagents that would bring about the following transformation.