One NEET question, every day
NEET question for Wed, 21 Oct, 2026
Test yourself: answer it here, free and without signing up, then read the explanation. A new question goes up at midnight IST.
Question of the day
BiologyMolecular Basis of Inheritance
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
Pick an option to see the answer and the explanation.
Come back tomorrow for the next one, or open any earlier question below.
Earlier questions
Today's question- Sun, 25 Oct, 2026Biology
- Sat, 24 Oct, 2026Biology
- Fri, 23 Oct, 2026Chemistry
- Thu, 22 Oct, 2026Physics
- Tue, 20 Oct, 2026Biology
- Mon, 19 Oct, 2026Chemistry
- Sun, 18 Oct, 2026Physics
- Sat, 17 Oct, 2026Biology
- Fri, 16 Oct, 2026Biology
- Thu, 15 Oct, 2026Chemistry
- Wed, 14 Oct, 2026Physics
- Tue, 13 Oct, 2026Biology
- Mon, 12 Oct, 2026Biology
- Sun, 11 Oct, 2026Chemistry