Biology Chapter PYQs

Molecular Basis of Inheritance PYQs

All NEET previous year questions from Molecular Basis of Inheritance — with explanations.

96Total PYQs
22Years
42Easy
47Medium
7Hard
Year:
Difficulty:96 questions

Showing 10 questions free. Sign up to attempt all 96 questions with AI explanations and progress tracking.

12026

The correct statement with regard to the secondary structure of DNA/RNA is:

Easy NEET 2026Class 12DNA and RNA
22026

In the lac operon, the z gene codes for:

Easy NEET 2026Class 12Gene Regulation
32026

Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily by three regions : promoter, structural gene and terminator. B. The promoter is said to be located towards the 5'-end of the structural gene. C. The promoter is a DNA sequence that provides binding site for RNA polymerase. D. The promoter defines the template and coding strands. E. The terminator is located towards the 3'-end of the coding strand and it defines the end of the process of transcription. Choose the correct answer from the options given below:

Medium NEET 2026Class 12Transcription
42026

Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its digestion by restriction endonucleases. B. Hybridisation using a labelled VNTR probe. C. Transferring of separated DNA fragments to synthetic membranes. D. Detection of hybridised DNA fragments by autoradiography. E. Separation of DNA fragments by electrophoresis. Choose the correct answer from the options given below :

Medium NEET 2026Class 12Human Genome Project and DNA Fingerprinting
52026

Which of the following statements are correct with reference to packaging of DNA helix? A. Histones are organized to form a unit of eight molecules called histone octamer. B. Histones are negatively charged basic proteins. C. Histones are rich in the basic amino acid residues - lysine and arginine. D. The positively charged DNA is wrapped around the histone octamer to form nucleosome. E. The packaging of chromatin at higher levels requires an additional set of proteins called non-histone chromosomal proteins. Choose the correct answer from the options given below :

Medium NEET 2026Class 12DNA and RNA
62025

Which chromosome in the human genome has the highest number of genes?

Medium NEET 2025Class 12Human Genome Project and DNA Fingerprinting
72025

Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5’ end of hnRNA. D. Addition of adenine residues at 3’ end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below :

Medium NEET 2025Class 12Transcription
82025

Match List I with List II : Choose the correct answer from the options given below:

Medium NEET 2025Class 12DNA and RNA
92025

Given below are two statements : Statement I : The DNA fragments extracted from gel electrophoresis can be used in construction of recombinant DNA. Statement II : Smaller size DNA fragments are observed near anode while larger fragments are found near the wells in an agarose gel. In the light of the above statements, choose the most appropriate answer from the options given below :

Medium NEET 2025Class 12Human Genome Project and DNA Fingerprinting
102025

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

Easy NEET 2025Class 12Genetic Code and Translation
112025

Which factor is important for termination of transcription?

Easy NEET 2025Class 12Transcription
122024

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;

Medium NEET 2024Class 12Transcription
132024

Match List I with List II Choose the correct answer from the options given below:

Hard NEET 2024Class 12Genetic Discoveries
142024

Which of the following statement is correct regarding the process of replication in E.coli?

Medium NEET 2024Class 12DNA Replication
152024

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Medium NEET 2024Class 12Transcription
162024

Match List I with List II : Choose the correct answer from the options given below :

Hard NEET 2024Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

172023

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

Easy NEET 2023Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

182023

Unequivocal proof that DNA is the genetic material was first proposed by

Easy NEET 2023Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

192023

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Medium NEET 2023Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

202023

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:

Medium NEET 2023Class 12RNA World and Evolution

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

212023

Broad palm with single palm crease is visible in a person suffering from-

Easy NEET 2023Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

222023

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?

Medium NEET 2023Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

232022

DNA polymorphism forms the basis of:

Easy NEET 2022Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

242022

The process of translation of mRNA to proteins begins as soon as:

Medium NEET 2022Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

252022

In an E. coli strain, i gene gets mutated and its product cannot bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?

Hard NEET 2022Class 12Gene Regulation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

262022

If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?

Medium NEET 2022Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

272022

Ten E.coli cells with ¹⁵N-dsDNA are incubated in medium containing ¹⁴N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from ¹⁵N?

Hard NEET 2022Class 12DNA Replication

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

282021

Complete the flow chart on central dogma.

Easy NEET 2021Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

292021

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

Medium NEET 2021Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

302021

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as:

Easy NEET 2021Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

312021

Identify the correct statement.

Medium NEET 2021Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

322021

Nowadays it is possible to detect the mutated gene causing cancer by allowing radioactive probe to hybridise its complementary DNA in a clone of cells, followed by its detection using autoradiography. The mutated gene is detected because:

Medium NEET 2021Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

332021

Which is the 'Only enzyme' that has capability to catalyse initiation, elongation and termination in the process of transcription in prokaryotes?

Medium NEET 2021Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

342021

If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

Medium NEET 2021Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

352021

Which one of the following statements about Histones is wrong?

Medium NEET 2021Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

362021

Statement I: The codon 'AUG' codes for methionine and phenylalanine. Statement II: 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light of the above statements, choose the correct answer from the options given below.

Easy NEET 2021Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

372020

The first phase of translation is:

Easy NEET 2020Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

382020

Name the enzyme that facilitates opening of DNA helix during transcription.

Easy NEET 2020Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

392020

If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 109^9 bp, then the length of the DNA is approximately

Medium NEET 2020Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

402020

Which of the following statements is correct?

Easy NEET 2020Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

412019

In RNAi, the genes are silenced using:

Easy NEET 2019Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

422019

From the following, identify the correct combination of salient features of Genetic Code

Easy NEET 2019Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

432019

Which scientist experimentally proved that DNA is the sole genetic material in bacteriophage?

Easy NEET 2019Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

442019

In the process of transcription in Eukaryotes, the RNA polymerase I transcribes -

Easy NEET 2019Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

452019

What initiation and termination factors are involved in transcription in Eukaryotes?

Easy NEET 2019Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

462019

Match the following RNA polymerases with their transcribed products: Select the correct option from the following :

Easy NEET 2019Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

472019

What will be the sequence of mRNA produced by the following stretch of DNA?

Easy NEET 2019Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

482018

All of the following are part of an operon except:

Easy NEET 2018Class 12Gene Regulation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

492018

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?

Easy NEET 2018Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

502018

Select the correct match:

Medium NEET 2018Class 12RNA and catalytic RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

512018

Select the correct match:

Medium NEET 2018Class 12Experiments and discoveries in genetics

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

522018

The experimental proof for semiconservative replication of DNA was first shown in a:

Easy NEET 2018Class 12DNA replication

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

532018

Select the correct statement:

Medium NEET 2018Class 12Important discoveries in genetics

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

542017

The final proof for DNA as the genetic material came from the experiments of

Easy NEET 2017Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

552017

Spliceosomes are not found in cells of

Easy NEET 2017Class 11Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

562017

During DNA replication, Okazaki fragments are used to elongate

Medium NEET 2017Class 12DNA Replication

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

572017

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of RNA becomes 998 bases, how many codons will be altered?

Medium NEET 2017Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

582017

What is the criterion for DNA fragments movement on agarose gel during gel electrophoresis?

Medium NEET 2017Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

592016

The central dogma of molecular genetics states that the genetic information flows from:

Easy NEET 2016Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

602016

Taylor conducted the experiments to prove semiconservative mode of chromosome replication on

Medium NEET 2016Class 12DNA Replication

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

612016

DNA-dependent RNA polymerase catalyzes transcription on one strand of DNA which is called

Easy NEET 2016Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

622015

Which one of the following is not applicable to RNA?

Medium NEET 2015Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

632015

Satellite DNA is important because it:

Medium NEET 2015Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

642014

Which one of the following is wrongly matched?

Easy NEET 2014Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

652014

Transformation was discovered by:

Easy NEET 2014Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

662014

Select the correct option:

Medium NEET 2014Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

672013

The diagram shows an important concept in the central dogma of DNA. Fill in the blanks A to C correctly.

Medium NEET 2013Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

682013

Which enzyme/s will be produced in a cell in which there is a nonsense mutation in the lac Y gene?

Hard NEET 2013Class 12Gene Regulation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

692012

Read the following four statements (A–D): (A) In transcription adenosine pairs with uracil (B) Regulation of lac operon by repressor is referred to as positive regulation (C) The human genome has approximately 50,000 genes (D) Haemophilia is a sex-linked recessive disease. How many of the above statements are right?

Medium NEET 2012Class 12Transcription, Lac Operon and Genetic Disorders

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

702012

Which one of the following represents a palindromic sequence in DNA?

Hard NEET 2012Class 12Palindromic DNA Sequences

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

712012

What is it that forms the basis of DNA fingerprinting?

Easy NEET 2012Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

722012

Which one of the following is a wrong statement regarding mutations?

Medium NEET 2012Class 12Mutation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

732011

The unequivocal proof of DNA as the genetic material came from the studies on a:

Medium NEET 2011Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

742011

In history of biology, human genome project led to the development of:

Easy NEET 2011Class 12Human Genome Project and DNA Fingerprinting

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

752010

In eukaryotic cell transcription, RNA splicing and RNA capping take place inside the :

Easy NEET 2010Class 11Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

762010

Which one of the following statements about the particular entity is true?

Medium NEET 2010Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

772010

The lac operon consists of :

Medium NEET 2010Class 12Gene Regulation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

782010

The 3′−5′3' - 5' phosphodiester linkages inside a polynucleotide chain serve to join :

Medium NEET 2010Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

792009

The segment of DNA that acts as the instrument manual for the synthesis of protein is:

Easy NEET 2009Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

802009

T.O. Diener discovered a:

Medium NEET 2009Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

812009

What is not true for genetic code?

Medium NEET 2009Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

822009

Removal of introns and joining the exons in a defined order in a transcription unit is called:

Easy NEET 2009Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

832009

Semiconservative replication of DNA was first demonstrated in:

Medium NEET 2009Class 12DNA Replication

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

842009

Whose experiments cracked the DNA code and discovered unequivocally that a genetic code is a triplet?

Medium NEET 2009Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

852008

In DNA, the complementary bases are

Easy NEET 2008Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

862008

In DNA molecules

Easy NEET 2008Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

872008

Which one of the following pairs of codons is correctly matched with their function or the signal for the particular amino acid?

Medium NEET 2008Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

882007

Match the column-I and Column-II :

Easy NEET 2007Class 12Match the Following

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

892006

Which antibiotic inhibits interaction between t-RNA and m-RNA during bacterial protein synthesis?

Medium NEET 2006Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

902006

Amino acid sequence in protein synthesis is decided by the sequence of:

Easy NEET 2006Class 12Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

912006

One gene – one enzyme hypothesis was postulated by:

Easy NEET 2006Class 12Gene-Enzyme Relationship

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

922006

One turn of the helix in a B-form DNA is approximately:

Easy NEET 2006Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

932006

Antiparallel strands of a DNA molecule means that:

Medium NEET 2006Class 12DNA and RNA

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

942005

During transcription holoenzyme RNA polymerase binds to a DNA sequence and the DNA assumes a saddle-like structure at that point. What is that sequence called?

Medium NEET 2005Class 12Transcription

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

952005

E. coli cells with a mutated Z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because:

Hard NEET 2005Class 12Gene Regulation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

962005

Protein synthesis in an animal cell occurs:

Easy NEET 2005Class 11Genetic Code and Translation

Sign up to attempt this question

Track your answers, get AI explanations & see your accuracy.

Get AI Explanations for Every PYQ

Sign up free and practice all 96 questions in Molecular Basis of Inheritance with detailed AI step-by-step solutions, weak topic detection, and progress tracking.