Molecular Basis of Inheritance PYQs

The correct statement with regard to the secondary structure of DNA/RNA is:

In the lac operon, the z gene codes for:

Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily by three regions : promoter, structural gene and terminator. B. The promoter is said to be located towards the 5'-end of the structural gene. C. The promoter is a DNA sequence that provides binding site for RNA polymerase. D. The promoter defines the template and coding strands. E. The terminator is located towards the 3'-end of the coding strand and it defines the end of the process of transcription. Choose the correct answer from the options given below:

Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its digestion by restriction endonucleases. B. Hybridisation using a labelled VNTR probe. C. Transferring of separated DNA fragments to synthetic membranes. D. Detection of hybridised DNA fragments by autoradiography. E. Separation of DNA fragments by electrophoresis. Choose the correct answer from the options given below :

Which of the following statements are correct with reference to packaging of DNA helix? A. Histones are organized to form a unit of eight molecules called histone octamer. B. Histones are negatively charged basic proteins. C. Histones are rich in the basic amino acid residues - lysine and arginine. D. The positively charged DNA is wrapped around the histone octamer to form nucleosome. E. The packaging of chromatin at higher levels requires an additional set of proteins called non-histone chromosomal proteins. Choose the correct answer from the options given below :

Which chromosome in the human genome has the highest number of genes?

Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5’ end of hnRNA. D. Addition of adenine residues at 3’ end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below:

Given below are two statements : Statement I : The DNA fragments extracted from gel electrophoresis can be used in construction of recombinant DNA. Statement II : Smaller size DNA fragments are observed near anode while larger fragments are found near the wells in an agarose gel. In the light of the above statements, choose the most appropriate answer from the options given below :

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

Which factor is important for termination of transcription?

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;

Match List I with List II Choose the correct answer from the options given below:

Which of the following statement is correct regarding the process of replication in E.coli?

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Match List I with List II : Choose the correct answer from the options given below :

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

Unequivocal proof that DNA is the genetic material was first proposed by

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:

Broad palm with single palm crease is visible in a person suffering from-

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?

DNA polymorphism forms the basis of:

The process of translation of mRNA to proteins begins as soon as:

In an E. coli strain, i gene gets mutated and its product cannot bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?

If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?

Ten E.coli cells with ¹⁵N-dsDNA are incubated in medium containing ¹⁴N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from ¹⁵N?

Complete the flow chart on central dogma.

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as:

Identify the correct statement.

Nowadays it is possible to detect the mutated gene causing cancer by allowing radioactive probe to hybridise its complementary DNA in a clone of cells, followed by its detection using autoradiography. The mutated gene is detected because:

Which is the 'Only enzyme' that has capability to catalyse initiation, elongation and termination in the process of transcription in prokaryotes?

If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

Which one of the following statements about Histones is wrong?

Statement I: The codon 'AUG' codes for methionine and phenylalanine. Statement II: 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light of the above statements, choose the correct answer from the options given below.

The first phase of translation is:

Name the enzyme that facilitates opening of DNA helix during transcription.

If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 10$^9$ bp, then the length of the DNA is approximately

Which of the following statements is correct?

In RNAi, the genes are silenced using:

From the following, identify the correct combination of salient features of Genetic Code

Which scientist experimentally proved that DNA is the sole genetic material in bacteriophage?

In the process of transcription in Eukaryotes, the RNA polymerase I transcribes -

What initiation and termination factors are involved in transcription in Eukaryotes?

Match the following RNA polymerases with their transcribed products: Select the correct option from the following :

What will be the sequence of mRNA produced by the following stretch of DNA?

All of the following are part of an operon except:

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?

Select the correct match:

Select the correct match:

The experimental proof for semiconservative replication of DNA was first shown in a:

Select the correct statement:

The final proof for DNA as the genetic material came from the experiments of

Spliceosomes are not found in cells of

During DNA replication, Okazaki fragments are used to elongate

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of RNA becomes 998 bases, how many codons will be altered?

What is the criterion for DNA fragments movement on agarose gel during gel electrophoresis?

The central dogma of molecular genetics states that the genetic information flows from:

Taylor conducted the experiments to prove semiconservative mode of chromosome replication on

DNA-dependent RNA polymerase catalyzes transcription on one strand of DNA which is called

Which one of the following is not applicable to RNA?

Satellite DNA is important because it:

Which one of the following is wrongly matched?

Transformation was discovered by:

Select the correct option:

The diagram shows an important concept in the central dogma of DNA. Fill in the blanks A to C correctly.

Which enzyme/s will be produced in a cell in which there is a nonsense mutation in the lac Y gene?

Read the following four statements (A–D): (A) In transcription adenosine pairs with uracil (B) Regulation of lac operon by repressor is referred to as positive regulation (C) The human genome has approximately 50,000 genes (D) Haemophilia is a sex-linked recessive disease. How many of the above statements are right?

Which one of the following represents a palindromic sequence in DNA?

What is it that forms the basis of DNA fingerprinting?

Which one of the following is a wrong statement regarding mutations?

The unequivocal proof of DNA as the genetic material came from the studies on a:

In history of biology, human genome project led to the development of:

In eukaryotic cell transcription, RNA splicing and RNA capping take place inside the :

Which one of the following statements about the particular entity is true?

The lac operon consists of :

The $3' - 5'$ phosphodiester linkages inside a polynucleotide chain serve to join :

The segment of DNA that acts as the instrument manual for the synthesis of protein is:

T.O. Diener discovered a:

What is not true for genetic code?

Removal of introns and joining the exons in a defined order in a transcription unit is called:

Semiconservative replication of DNA was first demonstrated in:

Whose experiments cracked the DNA code and discovered unequivocally that a genetic code is a triplet?

In DNA, the complementary bases are

In DNA molecules

Which one of the following pairs of codons is correctly matched with their function or the signal for the particular amino acid?

Match the column-I and Column-II :

Which antibiotic inhibits interaction between t-RNA and m-RNA during bacterial protein synthesis?

Amino acid sequence in protein synthesis is decided by the sequence of:

One gene – one enzyme hypothesis was postulated by:

One turn of the helix in a B-form DNA is approximately:

Antiparallel strands of a DNA molecule means that:

During transcription holoenzyme RNA polymerase binds to a DNA sequence and the DNA assumes a saddle-like structure at that point. What is that sequence called?

E. coli cells with a mutated Z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because:

Protein synthesis in an animal cell occurs: