Showing 10 questions free. Sign up to attempt all 175 questions with AI explanations and progress tracking.
Which one of the following is the site for active ribosomal RNA synthesis?
Non-membrane bound cell organelles found in both prokaryotic and eukaryotic cells are ______.
Choose the correct statements regarding cell organelles and their inclusions: A. The endomembrane system includes Golgi complex, endoplasmic reticulum and mitochondria. B. Rough endoplasmic reticulum bears ribosomes on its surface. C. Both mitochondria and plastids have circular DNA. D. A network of microtubules, microfilaments and intermediate filaments present in the cytoplasm is called cytoskeleton. E. Mitochondrion is a single membrane-bound structure. Choose the correct answer from the options given below :
Select the correct statements regarding cell membrane in eukaryotic cells: A. Membrane of human RBCs has approximately 52% protein. B. Major phospholipids are arranged in a bilayer. C. Extensions of plasma membrane into the cell form mesosomes. D. Tails towards the inner part of lipids are hydrophobic and thus protected from aqueous medium. E. Glycocalyx is present on the outer surface of the plasma membrane. Choose the correct answer from the options given below :
The complex II of mitochondrial electron transport chain is also known as
Which one of the following statements refers to Reductionist Biology?
From the statements given below choose the correct option: A. The eukaryotic ribosomes are 80S and prokaryotic ribosomes are 70S. B. Each ribosome has two sub-units. C. The two sub-units of 80S ribosome are 60S and 40S while that of 70S are 50S and 30S. D. The two sub-units of 80S ribosome are 60S and 20S and that of 70S are 50S and 20S. E. The two sub-units of 80S are 60S and 30S and that of 70S are 50S and 30S.
Name the class of enzyme that usually catalyze the following reaction : S − G + S# → S + S# − G Where, G → a group other than hydrogen S → a substrate S# → another substrate
Match List - I with List - II. Choose the correct answer from the options given below:
A specialised membranous structure in a prokaryotic cell which helps in cell wall formation, DNA replication and respiration is :
Which one of the following enzymes contains ‘Haem’ as the prosthetic group?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : The primary function of the Golgi apparatus is to package the materials made by the endoplasmic reticulum and deliver it to intracellular targets and outside the cell. Reason (R) : Vesicles containing materials made by the endoplasmic reticulum fuse with the cis face of the Golgi apparatus, and they are modified and released from the trans face of the Golgi apparatus. In the light of the above statements, choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
What is the main function of the spindle fibers during mitosis ?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The lactose present in the growth medium of bacteria is transported to the cell by the action of:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II Choose the correct answer from the options below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Spindle fibers attach to kinetochores of chromosomes during
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The DNA present in chloroplast is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : Statement I : Mitochondria and chloroplasts are both double membrane bound organelles. Statement II : Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast. In the light of the above statements, choose the most appropriate answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Regarding catalytic cycle of an enzyme action, select the correct sequential steps : A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds of the substrate broken. E. Substrate binding to active site. Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside. Statement II : When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Among eukaryotes, replication of DNA takes place in -
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Cellulose does not form blue colour with Iodine because
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following stages of meiosis involves division of centromere?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
How many different proteins does the ribosome consist of?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List I with List II : Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic Reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following functions is carried out by cytoskeleton in a cell?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Given below are two statements: Statement I: During phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following never occurs during mitotic cell division?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Read the following statements and choose the set of correct statements: (a) Euchromatin is loosely packed chromatin (b) Heterochromatin is transcriptionally active (c) Histone octomer is wrapped by negatively charged DNA in nucleosome (d) Histones are rich in lysine and arginine (e) A typical nucleosome contains 400 bp of DNA helix Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Read the following statements on lipids and find out the correct set of statements: (a) Lecithin found in the plasma membrane is a glycolipid (b) Saturated fatty acids possess one or more C=C bonds (c) Gingely oil has lower melting point, hence remains as oil in winter (d) Lipids are generally insoluble in water but soluble in some organic solvents (e) When fatty acid is esterified with glycerol, monoglycerides are formed Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List-I with List-II: Choose the correct answer from the options given below :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements with respect to Endoplasmic Reticulum is incorrect?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Regarding Meiosis, which of the statements is incorrect?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Select the incorrect statement with reference to mitosis:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following is an incorrect statement?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following stages of meiosis involves division of centromere?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List-I with List-II. Choose the correct answer from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
When the centromere is situated in the middle of two equal arms of chromosomes, the chromosome is referred as:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following are not secondary metabolites in plants?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match List-I with List-II. Choose the correct answer from the options given below.Match List-I with List-II. Choose the correct answer from the options given below.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which stage of meiotic prophase shows terminalisation of chiasmata as its distinctive feature?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The fruit fly has 8 chromosomes (2n) in each cell. During interphase of mitosis if the number of chromosomes at G₁ phase is 8, what would be the number of chromosomes after S phase?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The organelles that are included in the endomembrane system are:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The centriole undergoes duplication during:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Following are the statements with reference to lipids: (a) Lipids having only single bonds are called unsaturated fatty acids. (b) Lecithin is a phospholipid. (c) Trihydroxy propane is glycerol. (d) Palmitic acid has 20 carbon atoms including carboxyl carbon. Choose the correct answer from the options given below.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the types of cell junctions that help to stop leakage of substances across a tissue and facilitate communication with neighbouring cells via rapid transfer of ions and molecules.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the substances having glycosidic bond and peptide bond, respectively in their structure
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the correct statement with regard to phase (Gap 1) of interphase.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements about inclusion bodies is incorrect?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which is the important site of formation of glycoproteins and glycolipids in eukaryotic cells?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match the following with respect to meiosis: Select the correct option from the following.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Some dividing cells exit the cell cycle and enter vegetative inactive stage. This is called quiescent stage (G₀). This process occurs at the end of
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Dissolution of the synaptonemal complex occurs during
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match the column I with column II. Choose the correct match from the options given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Prosthetic groups differ from co-enzymes in that-
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Crossing over takes place between which chromatids and in which stage of the cell cycle?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match the following RNA polymerases with their transcribed products: Select the correct option from the following :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following cell organelles is present in the highest number in secretory cells?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Non-membranous nucleoplasmic structures in nucleus are the site for active synthesis of:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following nucleic acids is present in an organism having 70 S ribosomes only?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
After meiosis I, the resultant daughter cells have:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following organic compounds is the main constituent of Lecithin?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The main difference between active and passive transport across cell membranes is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match the following cell structure with its characteristic: Select the correct option from the following:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Nissl bodies are mainly composed of:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of these statements is incorrect?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following events does not occur in rough endoplasmic reticulum?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
What is the role of NAD+ in cellular respiration?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The Golgi complex participates in:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following is true for nucleolus?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Spliceosomes are not found in cells of
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The association of histone H1 with a nucleosome indicates:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
During DNA replication, Okazaki fragments are used to elongate
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following RNAs should be most abundant in animal cell?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which among the following are the smallest living cells, known without a definite cell wall, pathogenic to plants as well as animals and can survive without oxygen?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following components provides sticky character to the bacterial cell?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following statements is correct, with reference to enzymes?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of RNA becomes 998 bases, how many codons will be altered?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Anaphase promoting complex (APC) is a protein degradation machinery necessary for proper mitosis of animal cells. If APC is defective in a human cell, which of the following is expected to occur?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following cell organelles is responsible for extracting energy from carbohydrates to form ATP?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following are not polymeric?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
DNA replication in bacteria occurs
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following options gives the correct sequence of events during mitosis?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Select the mismatch.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A cell organelle containing hydrolytic enzymes is
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Oxidative phosphorylation is
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following describes the given graph correctly?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
When a cell has stalled DNA replication fork, which checkpoint should be predominantly activated?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match the stages of meiosis of Column-I to their characteristic features in Column-II and select the correct option using the codes given below:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following structures is not found in prokaryotic cells?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following are not membrane-bound?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Cellular organelles with membranes are:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Cell wall is absent in:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following biomolecules does have a phosphodiester bond?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A protoplast is a cell:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The function of the gap junction is to:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Arrange the following events of meiosis in correct sequence: (a) Crossing over (b) Synapsis (c) Terminalisation of chiasmata (d) Disappearance of nucleolus
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The structures that help some bacteria to attach to rocks and/or host tissues are:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match the columns and identify the correct option:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the correct order of organisation of genetic material from largest to smallest:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Balbiani rings are sites of:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which structures perform the function of mitochondria in bacteria?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The solid linear cytoskeletal elements having a diameter of 6 nm and made up of a single type of monomer are known as:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The osmotic expansion of a cell kept in water is chiefly regulated by:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Match the following and select the correct answer:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following shows coiled RNA strand and capsomeres?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Viruses have:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In 'S' phase of the cell cycle:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The motile bacteria are able to move by:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Select the option which is not correct with respect to enzyme action:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following is a non-reducing carbohydrate?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following statements is not correct?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A major site for synthesis of lipids is
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The most abundant intracellular cation is
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following criteria does not pertain to facilitated transport?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following is not correctly matched for the organism and its cell wall degrading enzyme?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The Golgi complex plays a major role
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following organelle in the figure correctly matches with its function?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following cellular parts is correctly described?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following structure is an organelle within an organelle?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The figure below shows the structure of a mitochondrion with its four parts labeled (A), (B), (C) and (D). Select the part correctly matched with its function.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In mitochondria, protons accumulate in the:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which one of the following is not considered as a part of the endomembrane system?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
In eukaryotic cell transcription, RNA splicing and RNA capping take place inside the :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Identify the components labelled A, B, C and D in the diagram below from the list (i) to (viii) given with. Components: (i) Cristae of mitochondria (ii) Inner membrane of mitochondria (iii) Cytoplasm (iv) Smooth endoplasmic reticulum (v) Rough endoplasmic reticulum (vi) Mitochondrial matrix (vii) Cell vacuole (viii) Nucleus The correct components are :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Three of the following statements about enzymes are correct and one is wrong. Which one is wrong?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The figure given below shows the conversion of a substrate into product by an enzyme. In which one of the four options (1-4) the components of reaction labelled as A, B, C and D are identified correctly?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
An elaborate network of filamentous proteinaceous structures present in the cytoplasm which helps in the maintenance of cell shape is called :
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Plasmodesmata are:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Stroma in the chloroplast of higher plant contains:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Middle lamella is composed mainly of:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Cytoskeleton is made up of:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Vacuole in a plant cell
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Polysome is formed by
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Carbohydrates are commonly found as starch in plant storage organs. Which of the following five properties of starch (a-e) make it useful as a storage material? a. Easily translocated b. Chemically non-reactive c. Easily digested by animals d. Osmotically inactive e. Synthesized during photosynthesis The useful properties are
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Keeping in view the 'fluid mosaic model' for the structure of cell membrane, which one of the following statements is correct with respect to the movement of lipids and proteins from one lipid monolayer to the other (described as flip-flop movement)?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The two sub-units of ribosome remain united at a critical ion level of
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The chemiosmotic coupling hypothesis of oxidative phosphorylation proposes that adenosine triphosphate (ATP) is formed because
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Write the location and function of Cytoskeleton.
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Refer diagram. Write the functions of parts (1) and (2).
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Refer diagram. Write the functions of parts (1) and (2).
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements regarding mitochondrial membrane is not correct?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A major breakthrough in the studies of cells came with the development of electron microscope. This is because:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements regarding cilia is not correct?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The cell membranes are mainly composed of:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The main organelle involved in modification and routing of newly synthesized proteins to their destinations is:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
At what stage of the cell cycle are histone proteins synthesized in a eukaryotic cell?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
A student wishes to study the cell structure under a light microscope having eyepiece and objective. He should illuminate the object by which one of the following colours of light so as to get the best possible resolution?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Centromere is required for:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Chlorophyll in chloroplasts is located in:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Nucleotide are building blocks of nucleic acids, nucleotide is a composite molecule formed by:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following is the simplest amino acid?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Enzymes, vitamins and hormones can be classified into a single category of biological chemicals, because all of these:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Protein synthesis in an animal cell occurs:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Which of the following statements regarding enzyme inhibition is correct?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
The catalytic efficiency of two different enzymes can be compared by the:
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Four healthy people in their twenties got involved in injuries resulting in damage and death of a few cells of the following. Which of the cells are least likely to be replaced by new cells?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
According to widely accepted 'fluid mosaic model' cell membranes are semi-fluid, where lipids and integral proteins can diffuse randomly. In recent years, this model has been modified in several respects. In this regard, which of the following statements is incorrect?
Sign up to attempt this question
Track your answers, get AI explanations & see your accuracy.
Get AI Explanations for Every PYQ
Sign up free and practice all 175 questions in Cell: The Unit of Life with detailed AI step-by-step solutions, weak topic detection, and progress tracking.