Cell: The Unit of Life PYQs

Which one of the following is the site for active ribosomal RNA synthesis?

Non-membrane bound cell organelles found in both prokaryotic and eukaryotic cells are ______.

Choose the correct statements regarding cell organelles and their inclusions: A. The endomembrane system includes Golgi complex, endoplasmic reticulum and mitochondria. B. Rough endoplasmic reticulum bears ribosomes on its surface. C. Both mitochondria and plastids have circular DNA. D. A network of microtubules, microfilaments and intermediate filaments present in the cytoplasm is called cytoskeleton. E. Mitochondrion is a single membrane-bound structure. Choose the correct answer from the options given below :

Select the correct statements regarding cell membrane in eukaryotic cells: A. Membrane of human RBCs has approximately 52% protein. B. Major phospholipids are arranged in a bilayer. C. Extensions of plasma membrane into the cell form mesosomes. D. Tails towards the inner part of lipids are hydrophobic and thus protected from aqueous medium. E. Glycocalyx is present on the outer surface of the plasma membrane. Choose the correct answer from the options given below :

The complex II of mitochondrial electron transport chain is also known as

Which one of the following statements refers to Reductionist Biology?

From the statements given below choose the correct option: A. The eukaryotic ribosomes are 80S and prokaryotic ribosomes are 70S. B. Each ribosome has two sub-units. C. The two sub-units of 80S ribosome are 60S and 40S while that of 70S are 50S and 30S. D. The two sub-units of 80S ribosome are 60S and 20S and that of 70S are 50S and 20S. E. The two sub-units of 80S are 60S and 30S and that of 70S are 50S and 30S.

Name the class of enzyme that usually catalyze the following reaction : S − G + S# → S + S# − G Where, G → a group other than hydrogen S → a substrate S# → another substrate

Match List - I with List - II. Choose the correct answer from the options given below:

A specialised membranous structure in a prokaryotic cell which helps in cell wall formation, DNA replication and respiration is :

Which one of the following enzymes contains ‘Haem’ as the prosthetic group?

Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : The primary function of the Golgi apparatus is to package the materials made by the endoplasmic reticulum and deliver it to intracellular targets and outside the cell. Reason (R) : Vesicles containing materials made by the endoplasmic reticulum fuse with the cis face of the Golgi apparatus, and they are modified and released from the trans face of the Golgi apparatus. In the light of the above statements, choose the correct answer from the options given below :

What is the main function of the spindle fibers during mitosis ?

The lactose present in the growth medium of bacteria is transported to the cell by the action of:

Match List I with List II Choose the correct answer from the options below:

Spindle fibers attach to kinetochores of chromosomes during

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

The DNA present in chloroplast is:

Match List I with List II Choose the correct answer from the options given below:

Match List I with List II : Choose the correct answer from the options given below:

Match List I with List II : Choose the correct answer from the options given below:

Match List I with List II : Choose the correct answer from the options given below :

Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below :

Given below are two statements : Statement I : Mitochondria and chloroplasts are both double membrane bound organelles. Statement II : Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast. In the light of the above statements, choose the most appropriate answer from the options given below :

Regarding catalytic cycle of an enzyme action, select the correct sequential steps : A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds of the substrate broken. E. Substrate binding to active site. Choose the correct answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below :

Given below are two statements: Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside. Statement II : When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:

The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

Among eukaryotes, replication of DNA takes place in -

Cellulose does not form blue colour with Iodine because

Which of the following stages of meiosis involves division of centromere?

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :

How many different proteins does the ribosome consist of?

Match List I with List II : Choose the correct answer from the options given below :

Match List I with List II : Choose the correct answer from the options given below :

Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic Reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

Which of the following functions is carried out by cytoskeleton in a cell?

Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?

Given below are two statements: Statement I: During $G_0$ phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:

Which of the following never occurs during mitotic cell division?

Read the following statements and choose the set of correct statements: (a) Euchromatin is loosely packed chromatin (b) Heterochromatin is transcriptionally active (c) Histone octomer is wrapped by negatively charged DNA in nucleosome (d) Histones are rich in lysine and arginine (e) A typical nucleosome contains 400 bp of DNA helix Choose the correct answer from the options given below:

Read the following statements on lipids and find out the correct set of statements: (a) Lecithin found in the plasma membrane is a glycolipid (b) Saturated fatty acids possess one or more C=C bonds (c) Gingely oil has lower melting point, hence remains as oil in winter (d) Lipids are generally insoluble in water but soluble in some organic solvents (e) When fatty acid is esterified with glycerol, monoglycerides are formed Choose the correct answer from the options given below:

Match List-I with List-II: Choose the correct answer from the options given below :

Which of the following statements with respect to Endoplasmic Reticulum is incorrect?

Regarding Meiosis, which of the statements is incorrect?

Select the incorrect statement with reference to mitosis:

Which of the following is an incorrect statement?

Which of the following stages of meiosis involves division of centromere?

Match List-I with List-II. Choose the correct answer from the options given below:

When the centromere is situated in the middle of two equal arms of chromosomes, the chromosome is referred as:

Which of the following are not secondary metabolites in plants?

Match List-I with List-II. Choose the correct answer from the options given below.Match List-I with List-II. Choose the correct answer from the options given below.

Which stage of meiotic prophase shows terminalisation of chiasmata as its distinctive feature?

The fruit fly has 8 chromosomes (2n) in each cell. During interphase of mitosis if the number of chromosomes at G₁ phase is 8, what would be the number of chromosomes after S phase?

The organelles that are included in the endomembrane system are:

The centriole undergoes duplication during:

Following are the statements with reference to lipids: (a) Lipids having only single bonds are called unsaturated fatty acids. (b) Lecithin is a phospholipid. (c) Trihydroxy propane is glycerol. (d) Palmitic acid has 20 carbon atoms including carboxyl carbon. Choose the correct answer from the options given below.

Identify the types of cell junctions that help to stop leakage of substances across a tissue and facilitate communication with neighbouring cells via rapid transfer of ions and molecules.

Identify the substances having glycosidic bond and peptide bond, respectively in their structure

Identify the correct statement with regard to $G_1$ phase (Gap 1) of interphase.

Which of the following statements about inclusion bodies is incorrect?

Which is the important site of formation of glycoproteins and glycolipids in eukaryotic cells?

Match the following with respect to meiosis: Select the correct option from the following.

Some dividing cells exit the cell cycle and enter vegetative inactive stage. This is called quiescent stage (G₀). This process occurs at the end of

Dissolution of the synaptonemal complex occurs during

Match the column I with column II. Choose the correct match from the options given below:

Prosthetic groups differ from co-enzymes in that-

Crossing over takes place between which chromatids and in which stage of the cell cycle?

Match the following RNA polymerases with their transcribed products: Select the correct option from the following :

Which of the following cell organelles is present in the highest number in secretory cells?

Non-membranous nucleoplasmic structures in nucleus are the site for active synthesis of:

Which of the following nucleic acids is present in an organism having 70 S ribosomes only?

After meiosis I, the resultant daughter cells have:

Which of the following organic compounds is the main constituent of Lecithin?

The main difference between active and passive transport across cell membranes is:

Match the following cell structure with its characteristic: Select the correct option from the following:

Nissl bodies are mainly composed of:

Which of these statements is incorrect?

Which of the following events does not occur in rough endoplasmic reticulum?

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as:

What is the role of NAD+ in cellular respiration?

The Golgi complex participates in:

Which of the following is true for nucleolus?

Spliceosomes are not found in cells of

The association of histone H1 with a nucleosome indicates:

During DNA replication, Okazaki fragments are used to elongate

Which of the following RNAs should be most abundant in animal cell?

Which among the following are the smallest living cells, known without a definite cell wall, pathogenic to plants as well as animals and can survive without oxygen?

Which of the following components provides sticky character to the bacterial cell?

Which one of the following statements is correct, with reference to enzymes?

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of RNA becomes 998 bases, how many codons will be altered?

Anaphase promoting complex (APC) is a protein degradation machinery necessary for proper mitosis of animal cells. If APC is defective in a human cell, which of the following is expected to occur?

Which of the following cell organelles is responsible for extracting energy from carbohydrates to form ATP?

Which of the following are not polymeric?

DNA replication in bacteria occurs

Which of the following options gives the correct sequence of events during mitosis?

Select the mismatch.

A cell organelle containing hydrolytic enzymes is

Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?

Oxidative phosphorylation is

Which of the following describes the given graph correctly?

When a cell has stalled DNA replication fork, which checkpoint should be predominantly activated?

Match the stages of meiosis of Column-I to their characteristic features in Column-II and select the correct option using the codes given below:

Which of the following structures is not found in prokaryotic cells?

Which of the following are not membrane-bound?

Cellular organelles with membranes are:

Cell wall is absent in:

Which of the following biomolecules does have a phosphodiester bond?

A protoplast is a cell:

The function of the gap junction is to:

Arrange the following events of meiosis in correct sequence: (a) Crossing over (b) Synapsis (c) Terminalisation of chiasmata (d) Disappearance of nucleolus

The structures that help some bacteria to attach to rocks and/or host tissues are:

Match the columns and identify the correct option:

Identify the correct order of organisation of genetic material from largest to smallest:

Balbiani rings are sites of:

Which structures perform the function of mitochondria in bacteria?

The solid linear cytoskeletal elements having a diameter of 6 nm and made up of a single type of monomer are known as:

The osmotic expansion of a cell kept in water is chiefly regulated by:

Match the following and select the correct answer:

Which of the following shows coiled RNA strand and capsomeres?

Viruses have:

In 'S' phase of the cell cycle:

The motile bacteria are able to move by:

Select the option which is not correct with respect to enzyme action:

Which one of the following is a non-reducing carbohydrate?

Which one of the following statements is not correct?

A major site for synthesis of lipids is