Genetics And Evolution PYQs

The correct statement with regard to the secondary structure of DNA/RNA is:

Given below are two statements: Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II : DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repair mechanism. In the light of the above statements, choose the most appropriate answer from the options given below:

Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5’ end of hnRNA. D. Addition of adenine residues at 3’ end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below :

What is the pattern of inheritance for polygenic trait?

Genes R and Y follow independent assortment. If RRYY produce round yellow seeds and rryy produce wrinkled green seeds, what will be the phenotypic ratio of the F2 generation?

Sweet potato and potato represent a certain type of evolution. Select the correct combination of terms to explain the evolution.

With the help of given pedigree, find out the probability for the birth of a child having no disease and being a carrier (has the disease mutation in one allele of the gene) in one of the $F_3$ generation.

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

Twins are born to a family that lives next door to you. The twins are a boy and a girl. Which of the following must be true?

Which one of the following can be explained on the basis of Mendel’s Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the characters appear as such in F₂ generation. C. Factors occur in pairs in normal diploid plants. D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct option:

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

Match List I with List II Choose the correct answer from the options given below:

Match List I with List II : Choose the correct answer from the options given below:

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below :

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

The flippers of the Penguins and Dolphins are the example of the

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

Match List I with List II : Choose the correct answer from the options given below :

As per ABO blood grouping system, the blood group of father is B$^+$, mother is A$^+$ and child is O$^+$. Their respective genotype can be Choose the most appropriate answer from the options given below :

The phenomenon of pleiotropism refers to

Unequivocal proof that DNA is the genetic material was first proposed by

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below :

Which one of the following symbols represents mating between relatives in human pedigree analysis?

Broad palm with single palm crease is visible in a person suffering from-

Which one of the following is NOT an advantage of inbreeding?

DNA polymorphism forms the basis of:

The appearance of recombination nodules on homologous chromosomes during meiosis characterizes:

XO type of sex determination can be found in:

The process of translation of mRNA to proteins begins as soon as:

Given below are two statements: Statement I: Mendel studied seven pairs of contrasting traits in pea plants and proposed the Laws of Inheritance. Statement II: Seven characters examined by Mendel in his experiment on pea plants were seed shape and colour, flower colour, pod shape and colour, flower position and stem height. In the light of the above statements, choose the correct answer from the options given below:

Which of the following occurs due to the presence of autosome linked dominant trait?

Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): Mendel's law of Independent assortment does not hold good for the genes that are located closely on the same chromosome. Reason (R): Closely located genes assort independently. In the light of the above statements, choose the correct answer from the options given below:

In an E. coli strain, i gene gets mutated and its product cannot bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?

Natural selection where more individuals acquire specific character value other than the mean character value, leads to:

If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?

The recombination frequency between genes a & c is 5%, b & c is 15%, b & d is 9%, a & b is 20%, c & d is 24% and a & d is 29%. What will be the sequence of these genes on a linear chromosome?

If a colour blind female marries a man whose mother was also colour blind, what are the chances of her progeny having colour blindness?

Ten E.coli cells with ¹⁵N-dsDNA are incubated in medium containing ¹⁴N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from ¹⁵N?

Which of the following statements is not true?

Identify the wrong statement with reference to the gene ‘I’ that controls ABO blood groups.

Select the correct match.

The first phase of translation is:

Embryological support for evolution was disproved by:

Which of the following refer to correct example(s) of organisms which have evolved due to changes in environment brought about by anthropogenic action? (a) Darwin's Finches of Galapagos islands (b) Herbicide resistant weeds (c) Drug resistant eukaryotes (d) Man-created breeds of domesticated animals like dogs.

How many true breeding pea plant varieties did Mendel select as pairs, which were similar except in one character with contrasting traits?

Name the enzyme that facilitates opening of DNA helix during transcription.

Flippers of Penguins and Dolphins are examples of

If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 10$^9$ bp, then the length of the DNA is approximately

Which of the following statements is correct?

Experimental verification of the chromosomal theory of inheritance was done by

In RNAi, the genes are silenced using:

From the following, identify the correct combination of salient features of Genetic Code

Which scientist experimentally proved that DNA is the sole genetic material in bacteriophage?

In the process of transcription in Eukaryotes, the RNA polymerase I transcribes -

In which genetic condition, each cell in the affected person, has three sex chromosomes XXY?

The production of gametes by the parents, the formation of zygotes, the $F_1$ and $F_2$ plants, can be understood using

In a marriage between male with blood group A and female with blood group B, the progeny had either blood group AB or B. What could be the possible genotype of parents?

A population of a species invades a new area. Which of the following condition will lead to Adaptive Radiation?

In Australia, marsupials and placental mammals have evolved to share many similar characteristics. This type of evolution may be referred to as

Match the items of Column-I with Column-II : Select the correct option from the following:

What will be the sequence of mRNA produced by the following stretch of DNA?

The final proof for DNA as the genetic material came from the experiments of

Homozygous purelines in cattle can be obtained by

Among the following characters, which one was not considered by Mendel in his experiments on pea?

Thalassemia and sickle cell anaemia are caused due to a problem in globin molecule synthesis. Select the correct statement.

Which one from those given below is the period for Mendel's hybridization experiments?

Artificial selection to obtain cows yielding higher milk output represents

The genotypes of a Husband and Wife are $I^A I^B$ and $I^A i$. Among the blood types of their children, how many different genotypes and phenotypes are possible?

A disease caused by an autosomal primary non-disjunction is

Taylor conducted the experiments to prove semiconservative mode of chromosome replication on

The mechanism that causes a gene to move from one linkage group to another is called

The equivalent of a structural gene is

A true breeding plant is

If a colour-blind man marries a woman who is homozygous for normal colour vision, the probability of their son being colour-blind is

Genetic drift operates in

In Hardy-Weinberg equation, the frequency of heterozygous individual is represented by

The chronological order of human evolution from early to recent is

Which of the following is the correct sequence of events in the origin of life?

A molecule that can act as a genetic material must fulfill the traits given below, except

DNA-dependent RNA polymerase catalyzes transcription on one strand of DNA which is called

Interspecific hybridization is the mating of

A colour blind man marries a woman with normal sight who has no history of colour blindness in her family. What is the probability of their grandson being colour blind?

The term "linkage" was coined by:

A pleiotropic gene:

In his classic experiments on pea plants, Mendel did not use:

A gene showing codominance has:

In the following human pedigree, the filled symbols represent the affected individuals. Identify the type of given pedigree.

Which one of the following is wrongly matched?

Transformation was discovered by:

Fruit colour in squash is an example of:

The enzyme recombinase is required at which stage of meiosis?

A man whose father was colour blind marries a woman who had a colour blind mother and normal father. What percentage of male children of this couple will be colour blind?

In a population of 1000 individuals, 360 belong to genotype AA, 480 to Aa and the remaining 160 to aa. Based on these data, the frequency of allele A in the population is:

A human female with Turner's syndrome:

Select the correct option:

Given below are four statements (A-D) each with one or two blanks. Select the option which correctly fills up the blanks in the statements. Statements: (A) Wings of butterfly and birds look alike and are the results of _____ (i) _____ evolution. (B) Miller showed that $CH_4$, $H_2$, $NH_3$ and _____ (i) _____, when exposed to electric discharge in a flask resulted in formation of _____ (ii) _____. (C) Vermiform appendix is a _____ (i) _____ organ and an _____ (ii) _____ evidence of evolution. (D) According to Darwin evolution took place due to _____ (i) _____ and _____ (ii) _____ of the fittest.

A cross in which an organism showing a dominant phenotype is crossed with the recessive parent in order to know its genotype is called :

The most apparent change during the evolutionary history of $Homo\ sapiens$ is traced in :

In Antirrhinum, two plants with pink flowers were hybridized. The F1 plants produced red, pink and white flowers in the proportion of 1 red : 2 pink : 1 white. What could be the genotype of the two plants used for hybridization? Red flower colour is determined by $RR$, and white by $rr$ genes.

The fruit fly $Drosophila\ melanogaster$ was found to be very suitable for experimental verification of chromosomal theory of inheritance by Morgan and his colleagues because :

ABO blood grouping is controlled by gene $I$ which has three alleles and show co-dominance. There are six genotypes. How many phenotypes in all are possible?

Study the pedigree chart of a certain family given below and select the correct conclusion which can be drawn for the character.

The segment of DNA that acts as the instrument manual for the synthesis of protein is:

T.O. Diener discovered a:

What is not true for genetic code?

Removal of introns and joining the exons in a defined order in a transcription unit is called:

Semiconservative replication of DNA was first demonstrated in:

Whose experiments cracked the DNA code and discovered unequivocally that a genetic code is a triplet?

Point mutation involves:

In the case of peppered moth (*Biston betularia*), the black-coloured form became dominant over the light-coloured form in England during industrial revolution. This is an example of:

Sickle cell anaemia is:

Study the pedigree chart given below. What does it show?

Select the incorrect statement from the following:

Haploids are more suitable for mutation studies than diploids. This is because

Which one of the following pairs of nitrogenous bases of nucleic acids is wrongly matched with the category mentioned against it?

Which one of the following conditions in humans is correctly matched with its chromosomal abnormality/linkage?

In DNA molecules

What is true about the isolated small tribal populations?

Which one of the following scientist's name is correctly matched with the theory put forth by him?

Darwin's Finches are an excellent example of

There are two opposing views about the origin of modern man. According to one view, Homo erectus in Asia was the ancestor of modern man. A study of variations of DNA however suggested African origin of modern man. What kind of observation on DNA variation could suggest this?

A man and a woman, who do not show any apparent signs of a certain inherited disease, have seven children (2 daughters and 5 sons). Three of the sons suffer from the given disease but none of the daughters are affected. Which of the following mode of inheritance do you suggest for this disease?

Telomerase is an enzyme which is a:

During transcription holoenzyme RNA polymerase binds to a DNA sequence and the DNA assumes a saddle-like structure at that point. What is that sequence called?

Genes for cytoplasmic male sterility in plants are generally located in:

Which one of the following hydrolyses internal phosphodiester bonds in a polynucleotide chain?

E. coli cells with a mutated Z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because:

Which one of the following phenomena supports Darwin's concept of natural selection in organic evolution?