NEET 2024 Biology Questions with Solutions

Explanation

The component labeled C represents the guard cell. Guard cells have thin outer walls and highly thickened inner walls, which help regulate the opening and closing of stomata.

Explanation

The IUCN (International Union for Conservation of Nature) releases the Red List of Threatened Species, which includes endangered species.

Explanation

The conservation of threatened species outside their natural habitat under human care is referred to as ex-situ biodiversity conservation.

Explanation

Mendel’s Law of Dominance states that factors occur in pairs and one factor can dominate over the other in expression. Thus statements A, C, D and E are correct. Statement B is incorrect because dominance results in expression of only one character in the F₁ generation.

Explanation

Permease helps in the transport of lactose into the bacterial cell in the lac operon system.

Explanation

Clostridium butylicum produces butyric acid, Saccharomyces cerevisiae produces ethanol, Trichoderma polysporum produces Cyclosporin-A, and Streptococcus produces streptokinase.

Explanation

In the Verhulst-Pearl logistic growth equation, K represents the carrying capacity of the environment.

Explanation

A transcription unit consists of three regions: promoter, structural gene, and terminator.

Explanation

Dedifferentiation is the process in which mature cells regain the capacity to divide, as seen in the formation of interfascicular cambium.

Explanation

Rhizopus is bread mould, Ustilago is smut fungus, Puccinia is rust fungus, and Agaricus is mushroom.

Explanation

The transferred DNA may integrate into the recipient genome and can also multiply independently if it possesses replication ability.

Explanation

Nucleolus is the site of active rRNA synthesis, centriole has cartwheel organization, leucoplasts store nutrients, and Golgi apparatus forms glycolipids.

Explanation

In figure (a), the ovary is superior and other floral parts arise below it, indicating a hypogynous flower. In figure (b), the ovary is inferior and floral parts arise above it, indicating an epigynous flower.

Explanation

During late prophase (prometaphase), spindle fibres attach to the kinetochores present on chromosomes.

Explanation

Major causes of biodiversity loss include habitat loss and fragmentation, over-exploitation, alien species invasions, and co-extinction. Mutation and migration are not considered major causes.

Explanation

Lecithin is a phospholipid commonly found in biological membranes.

Explanation

Water lily flowers are not water-pollinated. In hydrophytes, pollen grains are often protected from wetting, some are ribbon-like, and some are carried passively by water. Vallisneria flowers are not colourful nectar-producing flowers.

Explanation

Carboxypeptidase is a zinc-containing metalloenzyme, therefore zinc acts as its cofactor.

Explanation

Malonate structurally resembles succinate and competes for the active site of succinate dehydrogenase, resulting in competitive inhibition.

Explanation

Datura is an actinomorphic flower because it can be divided into two equal radial halves through multiple planes.

Explanation

During leptotene stage chromosomes begin to condense and become visible. Diplotene begins with the dissolution of the synaptonemal complex.

Explanation

In Snapdragon, flower colour shows incomplete dominance. Crossing pink (Rr) with red (RR) produces red (RR) and pink (Rr) offspring in a 1:1 ratio.

Explanation

Parenchyma and collenchyma are both living tissues, so Statement I is false. Gymnosperms generally lack xylem vessels while angiosperms possess them, so Statement II is true.

Explanation

Bt toxins are insect group specific and coded by cry genes such as cryIAc, so Statement I is true. The protoxin is activated in the alkaline pH of the insect gut, not acidic pH, making Statement II false.

Explanation

Fungi are mainly classified based on morphology of mycelium, mode of spore formation, and mode of nutrition. Fruiting body is not a primary criterion.

Explanation

Totipotency is the ability of a single plant cell to regenerate into a complete plant under suitable conditions.

Explanation

The dark reaction (Calvin cycle) requires CO₂, ATP, and NADPH. It does not directly require light or chlorophyll.

Explanation

Tropical regions have high biodiversity because they receive more solar energy, have remained undisturbed for long periods, possess stable predictable climates, and stable environments promote niche specialization.

Explanation

The radicle develops into the root during seed germination. In the given figure, label D represents the radicle.

Explanation

For fixation of one molecule of CO₂ in the Calvin cycle, 3 ATP molecules and 2 NADPH molecules are required.

Explanation

A test cross is performed with a homozygous recessive individual (bb) to determine the genotype of a dominant phenotype individual.

Explanation

Restriction enzyme Hind II recognizes a specific sequence of 6 base pairs in DNA and cuts at that recognition site.

Explanation

Bulliform cells help in rolling and unrolling of leaves in monocots, causing inward curling during water stress.

Explanation

Synthetic auxins selectively kill dicot weeds but do not significantly affect mature monocot grasses, allowing weed-free lawns.

Explanation

Rose is a perigynous flower, pea shows marginal placentation, cotton has twisted aestivation, and mango is a drupe fruit.

Explanation

Chloroplast DNA is circular and double stranded, similar to prokaryotic DNA.

Explanation

The figure represents an inflorescence adapted for wind pollination, where stamens are exposed to facilitate pollen dispersal by wind.

Explanation

Robert May estimated global species diversity at about 7 million, Alexander von Humboldt proposed species-area relationship, Paul Ehrlich proposed rivet popper hypothesis, and David Tilman performed long-term ecosystem experiments.

Explanation

In C₃ plants, oxygen competes with carbon dioxide for RuBisCO leading to photorespiration. In C₄ plants, bundle sheath cells lack photorespiration while mesophyll cells show very little photorespiration.

Explanation

Conversion of succinyl-CoA to succinic acid is coupled with substrate-level phosphorylation and does not involve oxidation.

Explanation

Somatic hybridization involves fusion of protoplasts from two different plant varieties.

Explanation

GLUT-4 enables glucose transport into cells, insulin is a hormone, trypsin is an enzyme, and collagen is an intercellular ground substance.

Explanation

Monadelphous stamens occur in China-rose, diadelphous in pea, polyadelphous in Citrus, and epiphyllous stamens in lily.

Explanation

In Phaeophyceae, reproduction may be isogamous, anisogamous or oogamous, so statement B is incorrect. All other statements are correct.

Explanation

Frederick Griffith discovered transformation, Jacob and Monod proposed the lac operon model, Har Gobind Khorana worked on deciphering genetic code, and Meselson & Stahl demonstrated semi-conservative DNA replication.

Explanation

DNA dependent DNA polymerase synthesizes DNA only in the 5’→3’ direction during replication in E.coli.

Explanation

Gibberellins promote stem elongation in plants such as sugarcane, thereby increasing yield.

Explanation

According to the 10% law of energy transfer, only about 10% of energy is transferred to the next trophic level. From first trophic level (100x), second trophic level receives 10x and third trophic level receives x.

Explanation

During diakinesis, terminalisation of chiasmata is completed. Recombination nodules appear during pachytene. Synaptonemal complex formation occurs in zygotene, and chromosomes appear as thin threads during leptotene. Hence the correct match is A-II, B-IV, C-I, D-III.

Explanation

Formation of oxyhaemoglobin is favored by high partial pressure of oxygen, low partial pressure of carbon dioxide, lower H⁺ concentration (higher pH), and lower temperature. Therefore, high pO₂ and lesser H⁺ concentration are the correct conditions.

Explanation

Typhoid is caused by the bacterium Salmonella typhi. Leishmaniasis is caused by protozoans of the genus Leishmania. Ringworm is a fungal infection, while filariasis is caused by nematode worms. Therefore, the correct matching is A-IV, B-III, C-I, D-II.

Explanation

Expiratory reserve capacity corresponds to expiratory reserve volume. Functional residual capacity equals expiratory reserve volume plus residual volume. Vital capacity equals inspiratory reserve volume + tidal volume + expiratory reserve volume. Inspiratory capacity equals tidal volume + inspiratory reserve volume. Hence the correct match is A-II, B-IV, C-I, D-III.

Explanation

Myasthenia gravis, rheumatoid arthritis, and systemic lupus erythematosus (SLE) are autoimmune disorders in which the immune system attacks the body's own tissues. Gout and muscular dystrophy are not autoimmune diseases. Therefore, the correct answer is A, B & E only.

Explanation

The descending limb of the loop of Henle is permeable to water and relatively impermeable to electrolytes, so Statement I is false. The proximal convoluted tubule is lined with simple cuboidal brush border epithelium that increases the surface area for reabsorption, so Statement II is true.

Explanation

Glucagon is a peptide hormone secreted by the pancreas, whereas progesterone, cortisol, and testosterone are steroid hormones derived from cholesterol.

Explanation

FSH acts on ovarian follicles in females and Sertoli cells in males, not Leydig cells. Therefore, Assertion A is false. The reason statement is true because growing ovarian follicles secrete estrogen and interstitial (Leydig) cells secrete androgens.

Explanation

The correct evolutionary sequence is Homo habilis → Homo erectus → Homo neanderthalensis → Homo sapiens. Therefore, the correct option is A-D-C-B.

Explanation

Figure (a) shows striated (skeletal) muscle found in voluntary muscles such as triceps. Figure (b) shows smooth muscle found in visceral organs like stomach. Figure (c) shows branched cardiac muscle found only in heart. Therefore, option (D) is correct. The official answer key for NEET UG 2024 (T1) lists Q161 → 4.

Explanation

Cocaine is obtained from Erythroxylum. Heroin is derived from Papaver somniferum. Morphine is used as an effective sedative in surgery. Marijuana is obtained from Cannabis sativa. Therefore, the correct match is A-III, B-IV, C-I, D-II.

Explanation

Ti plasmid in Agrobacterium tumefaciens stands for Tumor inducing plasmid. It is used as a vector in plant genetic engineering.

Explanation

RNA polymerase synthesizes RNA complementary to the DNA template strand in the 5’→3’ direction. Complementary pairing of the given template sequence produces the RNA strand 5’ AUGUACCGUUUAUAGGUAAGU 3’. Therefore, option (C) is correct.

Explanation

Pterophyllum is commonly called angel fish. Myxine is hag fish. Pristis is saw fish. Exocoetus is flying fish. Therefore, the correct match is A-III, B-I, C-II, D-IV.

Explanation

Fibrous joints are immovable joints found in the skull. Cartilaginous joints are present between adjacent vertebrae and allow limited movement. Hinge joints such as the knee help in locomotion. Ball and socket joints like the shoulder allow rotational movement between humerus and pectoral girdle.

Explanation

Breastfeeding during the initial period is highly recommended because colostrum contains antibodies that provide passive immunity to the newborn and help develop resistance against diseases. Therefore, both A and R are true, and R correctly explains A.

Explanation

The Fallopian tube consists of infundibulum, ampulla, and isthmus. Uterine fundus is a part of the uterus and not a component of the Fallopian tube.

Explanation

Pons acts as a bridge connecting different regions of the brain. Hypothalamus contains neurosecretory cells. Medulla controls respiration and gastric secretions. Cerebellum provides additional space for neurons and regulates posture and balance. Hence the correct match is A-III, B-IV, C-II, D-I.

Explanation

Lipase breaks ester bonds in lipids. Nuclease hydrolyses phosphodiester bonds in nucleic acids. Protease breaks peptide bonds in proteins, and amylase hydrolyses glycosidic bonds in carbohydrates. Therefore, the correct matching is A-II, B-IV, C-I, D-III.

Explanation

Lactational amenorrhea, coitus interruptus, and periodic abstinence are natural or traditional contraceptive methods. Vaults are barrier contraceptive devices and therefore are not natural contraceptive methods.

Explanation

The cardiac impulse originates at the SA node, then passes to the AV node, AV bundle, bundle branches, and finally Purkinje fibres. Hence the correct sequence is E-C-A-D-B.

Explanation

Pleurobrachia belongs to Ctenophora. Radula is a characteristic feeding organ of Mollusca. Stomochord is found in Hemichordata. Air bladder is present in Osteichthyes. Therefore, the correct matching is A-II, B-I, C-IV, D-III.

Explanation

Common cold is caused by rhinoviruses. Haemozoin is produced by Plasmodium. Widal test is used for diagnosis of typhoid. Allergy may be triggered by dust mites. Hence the correct matching is A-III, B-I, C-II, D-IV.

Explanation

The presence or absence of hymen is not a reliable indicator of virginity because the hymen can rupture due to physical activities such as sports or cycling. It is not necessarily torn only during first coitus. Hence Statement I is true and Statement II is false.

Explanation

Hardy-Weinberg equilibrium is maintained only when the gene pool remains constant. Factors like gene migration, genetic recombination, and genetic drift disturb the equilibrium. Therefore, constant gene pool does not affect the equilibrium.

Explanation

Lippes loop is a non-medicated IUD. Multiload 375 is a copper releasing IUD. LNG-20 is a hormone releasing IUD. Implants generally release progestogens. Therefore, the correct matching is A-III, B-I, C-IV, D-II.

Explanation

The correct order of cell cycle stages is G1 phase, S phase, G2 phase, followed by karyokinesis and cytokinesis. Hence the correct sequence is E-C-A-D-B.

Explanation

Juxtamedullary nephrons have long loops of Henle that extend deep into the renal medulla and help in concentrating urine. Cortical nephrons are more numerous, and renal corpuscles are located in the cortex.

Explanation

In enzyme action, the substrate first binds to the active site, forming the enzyme-substrate complex. Then chemical bonds are broken, products are released, and the enzyme becomes free to bind another substrate. Hence the correct sequence is E → A → D → C → B.

Explanation

P wave represents depolarisation of atria. QRS complex represents depolarisation of ventricles. T wave represents repolarisation of ventricles. T-P gap indicates a period when the heart muscles are electrically silent.

Explanation

Bone marrow is the primary lymphoid organ where all blood cells including lymphocytes are produced. However, T-lymphocytes mature in the thymus, while B-lymphocytes mature in the bone marrow. Therefore, Statement I is correct and Statement II is incorrect.

Explanation

The two cerebral hemispheres are connected by the corpus callosum. However, the brain stem consists of the midbrain, pons, and medulla oblongata, not the cerebrum. Hence Statement I is correct and Statement II is incorrect.

Explanation

Gause’s competitive exclusion principle states that two closely related species competing for the same resources cannot coexist indefinitely. Therefore, Statement I is false because it incorrectly says different resources. Statement II is correct because inferior competitors may be eliminated when resources are limited.

Explanation

Exophthalmic goiter is caused by hypersecretion of thyroid hormone and protruding eyeballs. Acromegaly results from excessive secretion of growth hormone. Cushing’s syndrome is caused by excess cortisol secretion leading to moon face and hyperglycemia. Cretinism is due to hyposecretion of thyroid hormone causing stunted growth. Therefore, the correct matching is A-III, B-IV, C-I, D-II.

Explanation

GnRH stimulates secretion of LH and FSH. LH acts on Leydig cells (B), which produce androgens required for formation of spermatids. FSH corresponds to (A), acts on Sertoli cells (C), which secrete factors helping conversion of spermatids into spermatozoa, i.e., spermiogenesis (D). Therefore: A = FSH, B = Leydig cells, C = Sertoli cells, D = spermiogenesis → option (C). The official NEET UG 2024 (T1) answer key lists Q198 → 3.