NEET 2023 · Biology

NEET 2023 Biology Questions with Solutions

The NEET 2023 paper had 103 Biology questions from 25 chapters. By section: 51 Botany and 52 Zoology.

Structural Organisation in Animals had the most questions (12), followed by Photosynthesis in Higher Plants with 10.

49 questions below have the answer and explanation free; the other 54 are in Premium.

Practise NEET 2023 Biology free
Biology questions
103
Chapters covered
25
Solved free here
49 of 103
Easy / Medium / Hard
43 / 58 / 2

Difficulty is NEET MIND's own tag for each question.

Chapter-wise: NEET 2023 Biology

How many questions each chapter had in NEET 2023. Open a chapter for its questions from every year.

  1. Structural Organisation in Animals· Zoology12 Qs
  2. Photosynthesis in Higher Plants· Botany10 Qs
  3. Cell: The Unit of Life· Botany7 Qs
  4. Ecosystem· Botany7 Qs
  5. Biotechnology: Principles and Processes· Botany6 Qs
  6. Body Fluids and Circulation· Zoology6 Qs
  7. Molecular Basis of Inheritance· Botany6 Qs
  8. Cell Cycle and Cell Division· Botany5 Qs
  9. Human Reproduction· Zoology5 Qs
  10. Principles of Inheritance and Variation· Botany5 Qs
  11. Biomolecules· Zoology3 Qs
  12. Human Health and Disease· Zoology3 Qs
  13. Organisms and Populations· Botany3 Qs
  14. Plant Growth and Development· Botany3 Qs
  15. Reproductive Health· Zoology3 Qs
  16. Sexual Reproduction in Flowering Plants· Botany3 Qs
  17. Biodiversity and Conservation· Botany2 Qs
  18. Biotechnology and Its Applications· Zoology2 Qs
  19. Chemical Coordination and Integration· Zoology2 Qs
  20. Excretory Products and Their Elimination· Zoology2 Qs
  21. Microbes in Human Welfare· Botany2 Qs
  22. Neural Control and Coordination· Zoology2 Qs
  23. The Living World· Zoology2 Qs
  24. Evolution· Zoology1 Q
  25. Locomotion and Movement· Zoology1 Q

All 103 NEET 2023 Biology questions

In paper order. Try each one, then open the answer where it is shown.

  1. Question 1 (NEET 2023, Q62)

    BiomoleculesZoologyEasy
    Given below are two statements: Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside. Statement II : When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is true but Statement II is false.
    4. Option D: Statement I is false but Statement II is true.

    The answer and explanation for this question are in NEET MIND Premium.

  2. Question 2 (NEET 2023, Q75)

    Body Fluids and CirculationZoologyEasy
    Which one of the following statements is correct?
    1. Option A: The daily requirement of Mg and Ca in the human body is estimated to be 0.2 - 0.3 g.
    2. Option B: All enzymes that utilise ATP in phosphate transfer require Ca as the cofactor.
    3. Option C: The bone in human body is an inert and unchanging substance.
    4. Option D: Mg plays roles in neuromuscular function and interneuronal transmission.
    Show answer & explanation

    Correct answer: (A) The daily requirement of Mg and Ca in the human body is estimated to be 0.2 - 0.3 g.

    Explanation

    The approximate daily requirement of magnesium and calcium in the human body is around 0.2–0.3 g. ATP-utilizing enzymes generally require Mg²⁺, not Ca²⁺. Bone is a dynamic tissue, and neuromuscular transmission is primarily associated with calcium.

  3. Question 3 (NEET 2023, Q98)

    EcosystemBotanyEasy
    Given below are two statements : Statement I : The nutrient deficient water bodies lead to eutrophication. Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the above statements, choose the correct answer from the options given below :
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is correct but Statement II is false.
    4. Option D: Statement I is incorrect but Statement II is true.
    Show answer & explanation

    Correct answer: (D) Statement I is incorrect but Statement II is true.

    Explanation

    Eutrophication occurs due to nutrient enrichment of water bodies, especially by nitrates and phosphates, not nutrient deficiency. Hence Statement I is false. Eutrophication promotes excessive growth of algae, and their decomposition consumes dissolved oxygen in water, decreasing oxygen levels. Hence Statement II is true.

  4. Question 4 (NEET 2023, Q101)

    Photosynthesis in Higher PlantsBotanyMedium
    Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R : Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from the options given below :
    1. Option A: Both A and R are correct and R is the correct explanation of A.
    2. Option B: Both A and R are correct but R is NOT the correct explanation of A.
    3. Option C: A is correct but R is not correct.
    4. Option D: A is not correct but R is correct.
    Show answer & explanation

    Correct answer: (A) Both A and R are correct and R is the correct explanation of A.

    Explanation

    In mosses, the spore germinates to form a protonema, which is the first stage of the gametophyte. Protonema develops directly from the spores produced in the capsule, hence the reason correctly explains the assertion.

  5. Question 5 (NEET 2023, Q102)

    Sexual Reproduction in Flowering PlantsBotanyMedium
    In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
    1. Option A: Synergids, Primary endosperm nucleus and zygote
    2. Option B: Antipodals, synergids, and primary endosperm nucleus
    3. Option C: Synergids, Zygote and Primary endosperm nucleus
    4. Option D: Synergids, antipodals and Polar nuclei
    Show answer & explanation

    Correct answer: (C) Synergids, Zygote and Primary endosperm nucleus

    Explanation

    Synergids are haploid structures. Zygote is diploid as it is formed by fusion of male and female gametes. Primary endosperm nucleus is triploid because it forms by triple fusion.

  6. Question 6 (NEET 2023, Q103)

    Photosynthesis in Higher PlantsBotanyEasy
    Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
    1. Option A: Osmosis
    2. Option B: Facilitated Diffusion
    3. Option C: Passive Transport
    4. Option D: Active Transport
    Show answer & explanation

    Correct answer: (D) Active Transport

    Explanation

    Movement of ions against the concentration gradient requires energy and occurs through active transport.

  7. Question 7 (NEET 2023, Q104)

    Sexual Reproduction in Flowering PlantsBotanyEasy
    Large, colourful, fragrant flowers with nectar are seen in :
    1. Option A: insect pollinated plants
    2. Option B: bird pollinated plants
    3. Option C: bat pollinated plants
    4. Option D: wind pollinated plants
    Show answer & explanation

    Correct answer: (A) insect pollinated plants

    Explanation

    Insect pollinated flowers are generally large, colourful, fragrant and nectar-producing to attract insects.

  8. Question 8 (NEET 2023, Q105)

    Principles of Inheritance and VariationBotanyMedium
    The phenomenon of pleiotropism refers to
    1. Option A: presence of several alleles of a single gene controlling a single crossover.
    2. Option B: presence of two alleles, each of the two genes controlling a single trait.
    3. Option C: a single gene affecting multiple phenotypic expression.
    4. Option D: more than two genes affecting a single character.

    The answer and explanation for this question are in NEET MIND Premium.

  9. Question 9 (NEET 2023, Q106)

    Plant Growth and DevelopmentBotanyEasy
    Which hormone promotes internode/petiole elongation in deep water rice?
    1. Option A: GA3GA_3
    2. Option B: Kinetin
    3. Option C: Ethylene
    4. Option D: 2, 4-D
    Show answer & explanation

    Correct answer: (C) Ethylene

    Explanation

    Ethylene promotes rapid internode elongation in deep water rice plants, helping them survive flooding conditions.

  10. Question 10 (NEET 2023, Q107)

    Biodiversity and ConservationBotanyMedium
    Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
    1. Option A: Habitat loss and fragmentation
    2. Option B: Over exploitation for economic gain
    3. Option C: Alien species invasions
    4. Option D: Co-extinctions
    Show answer & explanation

    Correct answer: (A) Habitat loss and fragmentation

    Explanation

    Habitat loss and fragmentation is considered the major cause of species extinction among the evil quartet.

  11. Question 11 (NEET 2023, Q108)

    Molecular Basis of InheritanceBotanyEasy
    Upon exposure to UV radiation, DNA stained with ethidium bromide will show
    1. Option A: Bright red colour
    2. Option B: Bright blue colour
    3. Option C: Bright yellow colour
    4. Option D: Bright orange colour

    The answer and explanation for this question are in NEET MIND Premium.

  12. Question 12 (NEET 2023, Q109)

    Photosynthesis in Higher PlantsBotanyMedium
    Which micronutrient is required for splitting of water molecule during photosynthesis?
    1. Option A: manganese
    2. Option B: molybdenum
    3. Option C: magnesium
    4. Option D: copper
    Show answer & explanation

    Correct answer: (A) manganese

    Explanation

    Manganese is a component of the oxygen evolving complex involved in photolysis of water during photosynthesis.

  13. Question 13 (NEET 2023, Q110)

    Plant Growth and DevelopmentBotanyMedium
    Axile placentation is observed in
    1. Option A: Mustard, Cucumber and Primrose
    2. Option B: China rose, Beans and Lupin
    3. Option C: Tomato, Dianthus and Pea
    4. Option D: China rose, Petunia and Lemon
    Show answer & explanation

    Correct answer: (D) China rose, Petunia and Lemon

    Explanation

    Axile placentation is found in flowers like China rose, Petunia and Lemon where ovules are attached to the central axis.

  14. Question 14 (NEET 2023, Q111)

    Cell: The Unit of LifeBotanyMedium
    The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
    1. Option A: Zygotene
    2. Option B: Pachytene
    3. Option C: Diplotene
    4. Option D: Diakinesis

    The answer and explanation for this question are in NEET MIND Premium.

  15. Question 15 (NEET 2023, Q112)

    Photosynthesis in Higher PlantsBotanyEasy
    The reaction centre in PS II has an absorption maxima at
    1. Option A: 680 nm
    2. Option B: 700 nm
    3. Option C: 660 nm
    4. Option D: 780 nm
    Show answer & explanation

    Correct answer: (A) 680 nm

    Explanation

    The reaction centre of Photosystem II is P680, which absorbs light maximally at 680 nm.

  16. Question 16 (NEET 2023, Q113)

    Molecular Basis of InheritanceBotanyEasy
    Unequivocal proof that DNA is the genetic material was first proposed by
    1. Option A: Frederick Griffith
    2. Option B: Alfred Hershey and Martha Chase
    3. Option C: Avery, Macleod and McCarthy
    4. Option D: Wilkins and Franklin

    The answer and explanation for this question are in NEET MIND Premium.

  17. Question 17 (NEET 2023, Q114)

    Cell Cycle and Cell DivisionBotanyEasy
    Among eukaryotes, replication of DNA takes place in -
    1. Option A: M phase
    2. Option B: S phase
    3. Option C: G1phaseG_1 phase
    4. Option D: G2phaseG_2 phase
    Show answer & explanation

    Correct answer: (B) S phase

    Explanation

    DNA replication in eukaryotic cells occurs during the S (Synthesis) phase of interphase.

  18. Question 18 (NEET 2023, Q115)

    Structural Organisation in AnimalsBotanyMedium
    In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as -
    1. Option A: Differentiation
    2. Option B: Dedifferentiation
    3. Option C: Development
    4. Option D: Senescence

    The answer and explanation for this question are in NEET MIND Premium.

  19. Question 19 (NEET 2023, Q116)

    BiomoleculesBotanyMedium
    Cellulose does not form blue colour with Iodine because
    1. Option A: It is a disaccharide.
    2. Option B: It is a helical molecule.
    3. Option C: It does not contain complex helices and hence cannot hold iodine molecules.
    4. Option D: It breaks down when iodine reacts with it.

    The answer and explanation for this question are in NEET MIND Premium.

  20. Question 20 (NEET 2023, Q117)

    Plant Growth and DevelopmentBotanyMedium
    Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
    1. Option A: Indole-3-butyric Acid
    2. Option B: Gibberellic Acid
    3. Option C: Zeatin
    4. Option D: Abscisic Acid
    Show answer & explanation

    Correct answer: (B) Gibberellic Acid

    Explanation

    Gibberellins, especially Gibberellic Acid (GA3), promote early maturity and flowering in juvenile conifers, leading to early seed production.

  21. Question 21 (NEET 2023, Q118)

    Photosynthesis in Higher PlantsBotanyMedium
    Given below are two statements : Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height. Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling. In the light of the above statements, choose the most appropriate answer from the options given below :
    1. Option A: Both Statement I and Statement II are correct.
    2. Option B: Both Statement I and Statement II are incorrect.
    3. Option C: Statement I is correct but Statement II is incorrect.
    4. Option D: Statement I is incorrect but Statement II is correct.

    The answer and explanation for this question are in NEET MIND Premium.

  22. Question 22 (NEET 2023, Q119)

    Structural Organisation in AnimalsBotanyHard
    Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
    1. Option A: Diadelphous and Dithecous anthers
    2. Option B: Polyadelphous and epipetalous stamens
    3. Option C: Monoadelphous and Monothecous anthers
    4. Option D: Epiphyllous and Dithecous anthers

    The answer and explanation for this question are in NEET MIND Premium.

  23. Question 23 (NEET 2023, Q120)

    Biotechnology: Principles and ProcessesBotanyMedium
    Expressed Sequence Tags (ESTs) refers to
    1. Option A: All genes that are expressed as RNA.
    2. Option B: All genes that are expressed as proteins.
    3. Option C: All genes whether expressed or unexpressed.
    4. Option D: Certain important expressed genes.

    The answer and explanation for this question are in NEET MIND Premium.

  24. Question 24 (NEET 2023, Q121)

    EcosystemBotanyHard
    Identify the correct statements : A. Detritivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below :
    1. Option A: A, B, C only
    2. Option B: B, C, D only
    3. Option C: C, D, E only
    4. Option D: D, E, A only
    Show answer & explanation

    Correct answer: (A) A, B, C only

    Explanation

    Statements A, B and C are correct. Detritivores perform fragmentation, humus is degraded during mineralization, and leaching involves downward movement of soluble nutrients. Detritus food chain starts with dead organic matter, not living organisms, and earthworms perform fragmentation rather than catabolism.

  25. Question 25 (NEET 2023, Q122)

    EcosystemBotanyEasy
    The thickness of ozone in a column of air in the atmosphere is measured in terms of :
    1. Option A: Dobson units
    2. Option B: Decibels
    3. Option C: Decameter
    4. Option D: Kilobase
    Show answer & explanation

    Correct answer: (A) Dobson units

    Explanation

    The thickness of the ozone layer is measured in Dobson units (DU).

  26. Question 26 (NEET 2023, Q123)

    Structural Organisation in AnimalsBotanyMedium
    Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below :
    1. Option A: Both A and R are true and R is the correct explanation of A.
    2. Option B: Both A and R are true but R is NOT the correct explanation of A.
    3. Option C: A is true but R is false.
    4. Option D: A is false but R is true.

    The answer and explanation for this question are in NEET MIND Premium.

  27. Question 27 (NEET 2023, Q124)

    Cell Cycle and Cell DivisionBotanyEasy
    Which of the following stages of meiosis involves division of centromere?
    1. Option A: Metaphase I
    2. Option B: Metaphase II
    3. Option C: Anaphase II
    4. Option D: Telophase
    Show answer & explanation

    Correct answer: (C) Anaphase II

    Explanation

    During Anaphase II of meiosis, centromeres divide and sister chromatids separate to opposite poles.

  28. Question 28 (NEET 2023, Q125)

    Biodiversity and ConservationBotanyEasy
    The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :
    1. Option A: 1985
    2. Option B: 1992
    3. Option C: 1986
    4. Option D: 2002
    Show answer & explanation

    Correct answer: (B) 1992

    Explanation

    The Earth Summit, formally known as the Convention on Biological Diversity, was held in Rio de Janeiro in 1992.

  29. Question 29 (NEET 2023, Q126)

    Photosynthesis in Higher PlantsBotanyMedium
    How many ATP and NADPH₂ are required for the synthesis of one molecule of Glucose during Calvin cycle?
    1. Option A: 12 ATP and 12 NADPH₂
    2. Option B: 18 ATP and 12 NADPH₂
    3. Option C: 12 ATP and 16 NADPH₂
    4. Option D: 18 ATP and 16 NADPH₂

    The answer and explanation for this question are in NEET MIND Premium.

  30. Question 30 (NEET 2023, Q127)

    EcosystemBotanyMedium
    In the equation GPP − R = NPP GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is ________.
    1. Option A: Photosynthetically active radiation
    2. Option B: Respiratory quotient
    3. Option C: Respiratory loss
    4. Option D: Reproductive allocation
    Show answer & explanation

    Correct answer: (C) Respiratory loss

    Explanation

    Net Primary Productivity (NPP) is calculated by subtracting respiratory loss (R) from Gross Primary Productivity (GPP).

  31. Question 31 (NEET 2023, Q128)

    Biotechnology: Principles and ProcessesBotanyEasy
    During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
    1. Option A: RNA
    2. Option B: DNA
    3. Option C: Histones
    4. Option D: Polysaccharides

    The answer and explanation for this question are in NEET MIND Premium.

  32. Question 32 (NEET 2023, Q129)

    Molecular Basis of InheritanceBotanyMedium
    What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
    1. Option A: Transcription of rRNAs (28S, 18S and 5.8S)
    2. Option B: Transcription of tRNA, 5S rRNA and snRNA
    3. Option C: Transcription of precursor mRNA
    4. Option D: Transcription of only snRNAs

    The answer and explanation for this question are in NEET MIND Premium.

  33. Question 33 (NEET 2023, Q130)

    Sexual Reproduction in Flowering PlantsBotanyEasy
    What is the function of tassels in the corn cob?
    1. Option A: To attract insects
    2. Option B: To trap pollen grains
    3. Option C: To disperse pollen grains
    4. Option D: To protect seeds
    Show answer & explanation

    Correct answer: (B) To trap pollen grains

    Explanation

    The tassels and silky structures associated with the corn cob help in trapping pollen grains for pollination.

  34. Question 34 (NEET 2023, Q131)

    Photosynthesis in Higher PlantsBotanyMedium
    Identify the pair of heterosporous pteridophytes among the following :
    1. Option A: Lycopodium and Selaginella
    2. Option B: Selaginella and Salvinia
    3. Option C: Psilotum and Salvinia
    4. Option D: Equisetum and Salvinia

    The answer and explanation for this question are in NEET MIND Premium.

  35. Question 35 (NEET 2023, Q132)

    Biotechnology: Principles and ProcessesBotanyEasy
    In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.
    1. Option A: Copper
    2. Option B: Zinc
    3. Option C: Tungsten or gold
    4. Option D: Silver

    The answer and explanation for this question are in NEET MIND Premium.

  36. Question 36 (NEET 2023, Q133)

    Structural Organisation in AnimalsBotanyEasy
    Given below are two statements : Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II : Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below :
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is correct but Statement II is false.
    4. Option D: Statement I is incorrect but Statement II is true.

    The answer and explanation for this question are in NEET MIND Premium.

  37. Question 37 (NEET 2023, Q134)

    Principles of Inheritance and VariationBotanyMedium
    Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
    1. Option A: Thomas Hunt Morgan
    2. Option B: Sutton and Boveri
    3. Option C: Alfred Sturtevant
    4. Option D: Henking

    The answer and explanation for this question are in NEET MIND Premium.

  38. Question 38 (NEET 2023, Q135)

    Cell: The Unit of LifeBotanyMedium
    Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :
    1. Option A: Both A and R are true and R is the correct explanation of A.
    2. Option B: Both A and R are true but R is NOT the correct explanation of A.
    3. Option C: A is true but R is false.
    4. Option D: A is false but R is true.

    The answer and explanation for this question are in NEET MIND Premium.

  39. Question 39 (NEET 2023, Q136)

    EcosystemBotanyMedium
    Which one of the following statements is NOT correct?
    1. Option A: The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms.
    2. Option B: Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
    3. Option C: Water hyacinth grows abundantly in eutrophic water bodies and leads to imbalance in the ecosystem dynamics of the water body.
    4. Option D: The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.
    Show answer & explanation

    Correct answer: (B) Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.

    Explanation

    Algal blooms deteriorate water quality by depleting dissolved oxygen and harming aquatic life. They do not improve fisheries or water quality.

  40. Question 40 (NEET 2023, Q137)

    Cell: The Unit of LifeBotanyEasy
    How many different proteins does the ribosome consist of?
    1. Option A: 80
    2. Option B: 60
    3. Option C: 40
    4. Option D: 20

    The answer and explanation for this question are in NEET MIND Premium.

  41. Question 41 (NEET 2023, Q138)

    Principles of Inheritance and VariationBotanyMedium
    Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below :
    1. Option A: A and B only
    2. Option B: C and D only
    3. Option C: B and E only
    4. Option D: A and E only

    The answer and explanation for this question are in NEET MIND Premium.

  42. Question 42 (NEET 2023, Q139)

    Cell: The Unit of LifeBotanyMedium
    Match List I with List II : Choose the correct answer from the options given below :
    1. Option A: A-III, B-IV, C-II, D-I
    2. Option B: A-II, B-IV, C-I, D-III
    3. Option C: A-III, B-I, C-II, D-IV
    4. Option D: A-II, B-IV, C-III, D-I

    The answer and explanation for this question are in NEET MIND Premium.

  43. Question 43 (NEET 2023, Q140)

    Human ReproductionBotanyMedium
    Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves. In the light of the above statements, choose the correct answer from the options given below :
    1. Option A: Both A and R are true and R is the correct explanation of A.
    2. Option B: Both A and R are true but R is NOT the correct explanation of A.
    3. Option C: A is true but R is false.
    4. Option D: A is false but R is true.

    The answer and explanation for this question are in NEET MIND Premium.

  44. Question 44 (NEET 2023, Q141)

    Human ReproductionBotanyMedium
    Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below :
    1. Option A: Both A and R are true and R is the correct explanation of A.
    2. Option B: Both A and R are true but R is NOT the correct explanation of A.
    3. Option C: A is true but R is false.
    4. Option D: A is false but R is true.

    The answer and explanation for this question are in NEET MIND Premium.

  45. Question 45 (NEET 2023, Q142)

    Photosynthesis in Higher PlantsBotanyEasy
    Match List I with List II : Choose the correct answer from the options given below :
    1. Option A: A-II, B-IV, C-I, D-III
    2. Option B: A-IV, B-III, C-II, D-I
    3. Option C: A-III, B-I, C-IV, D-II
    4. Option D: A-II, B-I, C-IV, D-III

    The answer and explanation for this question are in NEET MIND Premium.

  46. Question 46 (NEET 2023, Q143)

    Photosynthesis in Higher PlantsBotanyMedium
    Which of the following combinations is required for chemiosmosis?
    1. Option A: membrane, proton pump, proton gradient, ATP synthase
    2. Option B: membrane, proton pump, proton gradient, NADP synthase
    3. Option C: proton pump, electron gradient, ATP synthase
    4. Option D: proton pump, electron gradient, NADP synthase

    The answer and explanation for this question are in NEET MIND Premium.

  47. Question 47 (NEET 2023, Q144)

    Microbes in Human WelfareBotanyEasy
    Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
    1. Option A: Succinic dehydrogenase
    2. Option B: Amylase
    3. Option C: Lipase
    4. Option D: Dinitrogenase
    Show answer & explanation

    Correct answer: (A) Succinic dehydrogenase

    Explanation

    Malonate acts as a competitive inhibitor of succinate dehydrogenase in the Krebs cycle, thereby inhibiting bacterial respiration and growth.

  48. Question 48 (NEET 2023, Q145)

    Structural Organisation in AnimalsBotanyMedium
    Identify the correct statements : A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues exterior to vascular cambium. D. Bark refers to periderm and secondary phloem. E. Phellogen is single-layered in thickness. Choose the correct answer from the options given below :
    1. Option A: B, C and E only
    2. Option B: A and D only
    3. Option C: A, B and D only
    4. Option D: B and C only

    The answer and explanation for this question are in NEET MIND Premium.

  49. Question 49 (NEET 2023, Q146)

    Cell Cycle and Cell DivisionBotanyEasy
    Match List I with List II : Choose the correct answer from the options given below :
    1. Option A: A-III, B-II, C-IV, D-I
    2. Option B: A-IV, B-II, C-I, D-III
    3. Option C: A-IV, B-I, C-II, D-III
    4. Option D: A-II, B-IV, C-I, D-III
    Show answer & explanation

    Correct answer: (C) A-IV, B-I, C-II, D-III

    Explanation

    M phase is the equational division stage. G2 phase involves synthesis of proteins required for mitosis. Quiescent stage (G0) is an inactive phase. G1 phase is the interval between mitosis and initiation of DNA replication.

  50. Question 50 (NEET 2023, Q147)

    Organisms and PopulationsBotanyMedium
    Match List I with List II : Choose the correct answer from the options given below :
    1. Option A: A-IV, B-II, C-I, D-III
    2. Option B: A-IV, B-I, C-II, D-III
    3. Option C: A-IV, B-III, C-I, D-II
    4. Option D: A-III, B-I, C-IV, D-II
    Show answer & explanation

    Correct answer: (B) A-IV, B-I, C-II, D-III

    Explanation

    Mutualism benefits both species (+,+). Commensalism benefits one species while the other is unaffected (+,0). Amensalism harms one species while the other is unaffected (−,0). Parasitism benefits the parasite while harming the host (+,−).

  51. Question 51 (NEET 2023, Q148)

    Organisms and PopulationsBotanyMedium
    Given below are two statements : Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below :
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is correct but Statement II is false.
    4. Option D: Statement I is incorrect but Statement II is true.
    Show answer & explanation

    Correct answer: (C) Statement I is correct but Statement II is false.

    Explanation

    Gause’s Competitive Exclusion Principle correctly states that two closely related species competing for the same resources cannot coexist indefinitely. However, the statement that carnivores are more adversely affected by competition than herbivores is incorrect.

  52. Question 52 (NEET 2023, Q149)

    Photosynthesis in Higher PlantsBotanyMedium
    Match List I with List II : Choose the correct answer from the options given below :
    1. Option A: A-III, B-II, C-I, D-IV
    2. Option B: A-II, B-III, C-IV, D-I
    3. Option C: A-III, B-I, C-IV, D-II
    4. Option D: A-II, B-IV, C-I, D-III

    The answer and explanation for this question are in NEET MIND Premium.

  53. Question 53 (NEET 2023, Q150)

    Biotechnology: Principles and ProcessesBotanyEasy
    Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell. B. Cutting of DNA at specific location by restriction enzyme. C. Isolation of desired DNA fragment. D. Amplification of gene of interest using PCR. Choose the correct answer from the options given below :
    1. Option A: B, C, D, A
    2. Option B: C, A, B, D
    3. Option C: C, B, D, A
    4. Option D: B, D, A, C

    The answer and explanation for this question are in NEET MIND Premium.

  54. Question 54 (NEET 2023, Q151)

    Reproductive HealthZoologyEasy
    Match List I with List II. Choose the correct answer from the options below:
    1. Option A: A-III, B-I, C-IV, D-II
    2. Option B: A-III, B-IV, C-II, D-I
    3. Option C: A-II, B-III, C-I, D-IV
    4. Option D: A-IV, B-II, C-I, D-III
    Show answer & explanation

    Correct answer: (B) A-III, B-IV, C-II, D-I

    Explanation

    Vasectomy is a surgical contraceptive method. Coitus interruptus is a natural method. Cervical caps are barrier methods. Saheli is an oral contraceptive pill. Therefore, the correct matching is A-III, B-IV, C-II, D-I.

  55. Question 55 (NEET 2023, Q152)

    Human ReproductionZoologyMedium
    Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is correct but Statement II is false.
    4. Option D: Statement I is incorrect but Statement II is true.

    The answer and explanation for this question are in NEET MIND Premium.

  56. Question 56 (NEET 2023, Q153)

    EcosystemZoologyMedium
    Which of the following statements is correct?
    1. Option A: Eutrophication refers to increase in domestic sewage and waste water in lakes.
    2. Option B: Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
    3. Option C: Presence of large amount of nutrients in water restricts ‘Algal Bloom’.
    4. Option D: Algal Bloom decreases fish mortality.

    The answer and explanation for this question are in NEET MIND Premium.

  57. Question 57 (NEET 2023, Q154)

    Principles of Inheritance and VariationZoologyMedium
    Which one of the following symbols represents mating between relatives in human pedigree analysis?
    1. Option A: Option (1)
    2. Option B: Option (2)
    3. Option C: Option (3)
    4. Option D: Option (4)

    The answer and explanation for this question are in NEET MIND Premium.

  58. Question 58 (NEET 2023, Q155)

    Reproductive HealthZoologyEasy
    Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
    1. Option A: Genital herpes
    2. Option B: Gonorrhoea
    3. Option C: Hepatitis-B
    4. Option D: HIV Infection
    Show answer & explanation

    Correct answer: (B) Gonorrhoea

    Explanation

    Gonorrhoea is a bacterial sexually transmitted disease and can be completely cured if detected early and treated properly with antibiotics.

  59. Question 59 (NEET 2023, Q156)

    Human Health and DiseaseZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-II, B-I, C-IV, D-III
    2. Option B: A-I, B-II, C-III, D-IV
    3. Option C: A-IV, B-III, C-II, D-I
    4. Option D: A-III, B-IV, C-I, D-II
    Show answer & explanation

    Correct answer: (A) A-II, B-I, C-IV, D-III

    Explanation

    Heroin slows down body functions, marijuana affects the cardiovascular system, cocaine interferes with dopamine transport, and morphine is used as a painkiller. Therefore, the correct matching is A-II, B-I, C-IV, D-III.

  60. Question 60 (NEET 2023, Q157)

    Structural Organisation in AnimalsZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-III, B-I, C-II, D-IV
    2. Option B: A-II, B-IV, C-I, D-III
    3. Option C: A-I, B-IV, C-III, D-II
    4. Option D: A-II, B-IV, C-III, D-I

    The answer and explanation for this question are in NEET MIND Premium.

  61. Question 61 (NEET 2023, Q158)

    BiomoleculesZoologyEasy
    Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal) Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two subunits of β type). In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is true but Statement II is false.
    4. Option D: Statement I is false but Statement II is true.

    The answer and explanation for this question are in NEET MIND Premium.

  62. Question 62 (NEET 2023, Q159)

    Cell: The Unit of LifeZoologyEasy
    Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic Reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:
    1. Option A: B and D only
    2. Option B: A, C and E only
    3. Option C: A and D only
    4. Option D: A, D and E only

    The answer and explanation for this question are in NEET MIND Premium.

  63. Question 63 (NEET 2023, Q160)

    Molecular Basis of InheritanceZoologyMedium
    Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is true but Statement II is false.
    4. Option D: Statement I is false but Statement II is true.

    The answer and explanation for this question are in NEET MIND Premium.

  64. Question 64 (NEET 2023, Q161)

    Chemical Coordination and IntegrationZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-IV, B-III, C-II, D-I
    2. Option B: A-III, B-II, C-IV, D-I
    3. Option C: A-II, B-IV, C-I, D-III
    4. Option D: A-IV, B-II, C-III, D-I
    Show answer & explanation

    Correct answer: (A) A-IV, B-III, C-II, D-I

    Explanation

    CCK acts on pancreas, GIP acts on gastric glands, ANF acts on heart function and ADH acts mainly on kidneys.

  65. Question 65 (NEET 2023, Q162)

    Human ReproductionZoologyMedium
    Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both A and R are true and R is the correct explanation of A.
    2. Option B: Both A and R are true but R is NOT the correct explanation of A.
    3. Option C: A is true but R is false.
    4. Option D: A is false but R is true.

    The answer and explanation for this question are in NEET MIND Premium.

  66. Question 66 (NEET 2023, Q163)

    Human Health and DiseaseZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-II, B-III, C-IV, D-I
    2. Option B: A-II, B-III, C-I, D-IV
    3. Option C: A-III, B-II, C-I, D-IV
    4. Option D: A-III, B-II, C-IV, D-I
    Show answer & explanation

    Correct answer: (A) A-II, B-III, C-IV, D-I

    Explanation

    Ringworm is caused by Trichophyton, filariasis by Wuchereria bancrofti, malaria by Plasmodium vivax and pneumonia may be caused by Haemophilus influenzae.

  67. Question 67 (NEET 2023, Q164)

    Biotechnology and Its ApplicationsZoologyEasy
    Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is true but Statement II is false.
    4. Option D: Statement I is false but Statement II is true.
    Show answer & explanation

    Correct answer: (A) Both Statement I and Statement II are true.

    Explanation

    Low temperature temporarily inactivates enzymes while high temperature denatures proteins and destroys enzyme activity. Competitive inhibitors resemble the substrate structurally and compete for the active site of the enzyme. Therefore, both statements are true.

  68. Question 68 (NEET 2023, Q165)

    Structural Organisation in AnimalsZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-I, B-II, C-III, D-IV
    2. Option B: A-I, B-II, C-IV, D-III
    3. Option C: A-III, B-II, C-IV, D-I
    4. Option D: A-II, B-I, C-IV, D-III

    The answer and explanation for this question are in NEET MIND Premium.

  69. Question 69 (NEET 2023, Q166)

    Biotechnology and Its ApplicationsZoologyEasy
    Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
    1. Option A: Recombinant DNA Technology
    2. Option B: Serum and Urine analysis
    3. Option C: Polymerase Chain Reaction (PCR) technique
    4. Option D: Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
    Show answer & explanation

    Correct answer: (B) Serum and Urine analysis

    Explanation

    Serum and urine analysis are generally used after the disease symptoms appear and are not effective for very early diagnosis. PCR, ELISA, and recombinant DNA technology are molecular diagnostic tools useful for early detection.

  70. Question 70 (NEET 2023, Q167)

    EcosystemZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-I, B-II, C-III, D-IV
    2. Option B: A-I, B-II, C-IV, D-III
    3. Option C: A-III, B-IV, C-I, D-II
    4. Option D: A-II, B-III, C-I, D-IV

    The answer and explanation for this question are in NEET MIND Premium.

  71. Question 71 (NEET 2023, Q168)

    Structural Organisation in AnimalsZoologyEasy
    Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is true but Statement II is false.
    4. Option D: Statement I is false but Statement II is true.

    The answer and explanation for this question are in NEET MIND Premium.

  72. Question 72 (NEET 2023, Q169)

    Cell: The Unit of LifeZoologyEasy
    Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both Statement I and Statement II are true.
    2. Option B: Both Statement I and Statement II are false.
    3. Option C: Statement I is correct but Statement II is false.
    4. Option D: Statement I is incorrect but Statement II is true.

    The answer and explanation for this question are in NEET MIND Premium.

  73. Question 73 (NEET 2023, Q170)

    Neural Control and CoordinationZoologyMedium
    Match List I with List II with respect to human eye. Choose the correct answer from the options given below:
    1. Option A: A-III, B-I, C-IV, D-II
    2. Option B: A-IV, B-III, C-II, D-I
    3. Option C: A-I, B-IV, C-III, D-II
    4. Option D: A-II, B-I, C-III, D-IV
    Show answer & explanation

    Correct answer: (A) A-III, B-I, C-IV, D-II

    Explanation

    Fovea is the point of greatest visual acuity. Iris is the coloured portion regulating pupil diameter. Blind spot is the point where the optic nerve exits and photoreceptors are absent. Sclera is the outer dense connective tissue layer.

  74. Question 74 (NEET 2023, Q171)

    EvolutionZoologyMedium
    Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
    1. Option A: Tasmanian wolf, Bobcat, Marsupial mole
    2. Option B: Numbat, Spotted cuscus, Flying phalanger
    3. Option C: Mole, Flying squirrel, Tasmanian tiger cat
    4. Option D: Lemur, Anteater, Wolf
    Show answer & explanation

    Correct answer: (B) Numbat, Spotted cuscus, Flying phalanger

    Explanation

    Australian marsupials such as numbat, spotted cuscus and flying phalanger are examples of adaptive radiation. The other groups contain placental mammals or unrelated animals.

  75. Question 75 (NEET 2023, Q172)

    Human ReproductionZoologyMedium
    Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between the menarche and menopause. Choose the most appropriate answer from the options given below:
    1. Option A: A and D only
    2. Option B: A and B only
    3. Option C: A, B and C only
    4. Option D: A, C and D only

    The answer and explanation for this question are in NEET MIND Premium.

  76. Question 76 (NEET 2023, Q173)

    Body Fluids and CirculationZoologyEasy
    Vital capacity of lung is ________.
    1. Option A: IRV + ERV
    2. Option B: IRV + ERV + TV + RV
    3. Option C: IRV + ERV + TV − RV
    4. Option D: IRV + ERV + TV
    Show answer & explanation

    Correct answer: (D) IRV + ERV + TV

    Explanation

    Vital capacity is the maximum volume of air a person can expel after maximum inspiration and is equal to Inspiratory Reserve Volume (IRV) + Expiratory Reserve Volume (ERV) + Tidal Volume (TV).

  77. Question 77 (NEET 2023, Q174)

    Body Fluids and CirculationZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-III, B-I, C-IV, D-II
    2. Option B: A-IV, B-III, C-II, D-I
    3. Option C: A-II, B-IV, C-I, D-III
    4. Option D: A-I, B-II, C-III, D-IV
    Show answer & explanation

    Correct answer: (A) A-III, B-I, C-IV, D-II

    Explanation

    P-wave represents depolarisation of atria. Q-wave marks the beginning of systole. QRS complex represents depolarisation of ventricles, and T-wave represents repolarisation of ventricles.

  78. Question 78 (NEET 2023, Q175)

    Reproductive HealthZoologyEasy
    Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R: Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both A and R are true and R is the correct explanation of A.
    2. Option B: Both A and R are true but R is NOT the correct explanation of A.
    3. Option C: A is true but R is false.
    4. Option D: A is false but R is true.
    Show answer & explanation

    Correct answer: (D) A is false but R is true.

    Explanation

    Amniocentesis for sex determination is banned in India and is not a strategy under the Reproductive and Child Health Care Programme. The ban was imposed because sex determination led to an increase in female foeticide. Therefore, Assertion A is false but Reason R is true.

  79. Question 79 (NEET 2023, Q176)

    Body Fluids and CirculationZoologyEasy
    Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-
    1. Option A: Sphincter of Oddi
    2. Option B: Ileo-caecal valve
    3. Option C: Gastro-oesophageal sphincter
    4. Option D: Pyloric sphincter
    Show answer & explanation

    Correct answer: (B) Ileo-caecal valve

    Explanation

    The ileo-caecal valve is present between the ileum and caecum and prevents the backflow of substances from the caecum into the small intestine.

  80. Question 80 (NEET 2023, Q177)

    Biotechnology: Principles and ProcessesZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-II, B-I, C-IV, D-III
    2. Option B: A-II, B-III, C-IV, D-I
    3. Option C: A-III, B-IV, C-I, D-II
    4. Option D: A-III, B-I, C-IV, D-II

    The answer and explanation for this question are in NEET MIND Premium.

  81. Question 81 (NEET 2023, Q178)

    Body Fluids and CirculationZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-IV, B-III, C-II, D-I
    2. Option B: A-II, B-I, C-III, D-IV
    3. Option C: A-III, B-I, C-IV, D-II
    4. Option D: A-II, B-IV, C-I, D-III
    Show answer & explanation

    Correct answer: (C) A-III, B-I, C-IV, D-II

    Explanation

    Peptic cells secrete pepsinogen, goblet cells secrete mucus, oxyntic cells secrete HCl and intrinsic factor, and hepatic cells produce bile juice. Therefore the correct matching is A-III, B-I, C-IV, D-II.

  82. Question 82 (NEET 2023, Q179)

    Cell: The Unit of LifeZoologyEasy
    Which of the following functions is carried out by cytoskeleton in a cell?
    1. Option A: Nuclear division
    2. Option B: Protein synthesis
    3. Option C: Motility
    4. Option D: Transportation

    The answer and explanation for this question are in NEET MIND Premium.

  83. Question 83 (NEET 2023, Q180)

    Excretory Products and Their EliminationZoologyMedium
    Given below are statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Nephrons are of two types: Cortical and Juxta medullary, based on their relative position in cortex and medulla. Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below:
    1. Option A: Both A and R are true and R is the correct explanation of A.
    2. Option B: Both A and R are true but R is NOT the correct explanation of A.
    3. Option C: A is true but R is false.
    4. Option D: A is false but R is true.
    Show answer & explanation

    Correct answer: (C) A is true but R is false.

    Explanation

    Nephrons are classified into cortical and juxtamedullary nephrons based on their position. Juxtamedullary nephrons possess a long loop of Henle, while cortical nephrons have a shorter loop. Hence Assertion A is true but Reason R is false.

  84. Question 84 (NEET 2023, Q181)

    Microbes in Human WelfareZoologyEasy
    Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations. In the light of the above statements, choose the most appropriate answer from the options given below:
    1. Option A: Both Statement I and Statement II are correct.
    2. Option B: Both Statement I and Statement II are incorrect.
    3. Option C: Statement I is correct but Statement II is incorrect.
    4. Option D: Statement I is incorrect but Statement II is correct.
    Show answer & explanation

    Correct answer: (C) Statement I is correct but Statement II is incorrect.

    Explanation

    Electrostatic precipitators are widely used in thermal power plants to remove particulate matter from exhaust gases. They do not remove ionising radiations. Therefore, Statement I is correct and Statement II is incorrect.

  85. Question 85 (NEET 2023, Q182)

    Molecular Basis of InheritanceZoologyEasy
    Broad palm with single palm crease is visible in a person suffering from-
    1. Option A: Down's syndrome
    2. Option B: Turner's syndrome
    3. Option C: Klinefelter's syndrome
    4. Option D: Thalassemia

    The answer and explanation for this question are in NEET MIND Premium.

  86. Question 86 (NEET 2023, Q183)

    The Living WorldZoologyEasy
    Radial symmetry is NOT found in adults of phylum ______.
    1. Option A: Ctenophora
    2. Option B: Hemichordata
    3. Option C: Coelenterata
    4. Option D: Echinodermata

    The answer and explanation for this question are in NEET MIND Premium.

  87. Question 87 (NEET 2023, Q184)

    Human Health and DiseaseZoologyMedium
    In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
    1. Option A: THcellsT_H cells
    2. Option B: B-lymphocytes
    3. Option C: Basophils
    4. Option D: Eosinophils
    Show answer & explanation

    Correct answer: (A) THcellsT_H cells

    Explanation

    HIV primarily infects helper T-lymphocytes (T_H cells), where it replicates and produces progeny viruses.

  88. Question 88 (NEET 2023, Q185)

    Biotechnology: Principles and ProcessesZoologyEasy
    Which of the following is not a cloning vector?
    1. Option A: BAC
    2. Option B: YAC
    3. Option C: pBR322
    4. Option D: Probe

    The answer and explanation for this question are in NEET MIND Premium.

  89. Question 89 (NEET 2023, Q186)

    Organisms and PopulationsZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-II, B-I, C-III, D-IV
    2. Option B: A-II, B-III, C-I, D-IV
    3. Option C: A-II, B-IV, C-I, D-III
    4. Option D: A-II, B-IV, C-III, D-I
    Show answer & explanation

    Correct answer: (A) A-II, B-I, C-III, D-IV

    Explanation

    Logistic growth occurs under limited resources, exponential growth under unlimited resources, expanding pyramids have maximum pre-reproductive individuals, and stable pyramids have nearly equal pre-reproductive and reproductive groups.

  90. Question 90 (NEET 2023, Q187)

    The Living WorldZoologyMedium
    Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart. E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below:
    1. Option A: A, C and D only
    2. Option B: B and C only
    3. Option C: B, D and E only
    4. Option D: C, D and E only

    The answer and explanation for this question are in NEET MIND Premium.

  91. Question 91 (NEET 2023, Q188)

    Neural Control and CoordinationZoologyEasy
    The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :
    1. Option A: Limbic system & hypothalamus
    2. Option B: Corpora quadrigemina & hippocampus
    3. Option C: Brain stem & epithalamus
    4. Option D: Corpus callosum and thalamus
    Show answer & explanation

    Correct answer: (A) Limbic system & hypothalamus

    Explanation

    The limbic system along with hypothalamus regulates emotional reactions, sexual behaviour, pleasure, rage and fear.

  92. Question 92 (NEET 2023, Q189)

    Structural Organisation in AnimalsZoologyEasy
    The unique mammalian characteristics are:
    1. Option A: hairs, tympanic membrane and mammary glands
    2. Option B: hairs, pinna and mammary glands
    3. Option C: hairs, pinna and indirect development
    4. Option D: pinna, monocondylic skull and mammary glands

    The answer and explanation for this question are in NEET MIND Premium.

  93. Question 93 (NEET 2023, Q190)

    Chemical Coordination and IntegrationZoologyMedium
    Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of R.B.Cs formation Choose the correct answer from the options given below:
    1. Option A: A and D only
    2. Option B: B and C only
    3. Option C: C and D only
    4. Option D: D and E only
    Show answer & explanation

    Correct answer: (C) C and D only

    Explanation

    Thyroid hormones regulate basal metabolic rate and support RBC formation. Sleep-wake rhythm is mainly controlled by melatonin, while immune system development is associated with thymus hormones.

  94. Question 94 (NEET 2023, Q191)

    Cell Cycle and Cell DivisionZoologyMedium
    Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:
    1. Option A: A and C only
    2. Option B: B and D only
    3. Option C: A, C and E only
    4. Option D: B and E only
    Show answer & explanation

    Correct answer: (B) B and D only

    Explanation

    Centromeres split during anaphase and organelles reform during telophase. Tetrad formation occurs during zygotene, terminalization during diplotene and crossing over occurs between non-sister chromatids.

  95. Question 95 (NEET 2023, Q192)

    Structural Organisation in AnimalsZoologyMedium
    Match List I with List II. Choose the correct answer from the options given below:
    1. Option A: A-I, B-II, C-IV, D-III
    2. Option B: A-II, B-III, C-I, D-IV
    3. Option C: A-II, B-I, C-IV, D-III
    4. Option D: A-III, B-IV, C-II, D-I

    The answer and explanation for this question are in NEET MIND Premium.

  96. Question 96 (NEET 2023, Q193)

    Structural Organisation in AnimalsZoologyEasy
    Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
    1. Option A: Dark brown body colour and anal cerci
    2. Option B: Presence of anal styles
    3. Option C: Presence of sclerites
    4. Option D: Presence of anal cerci

    The answer and explanation for this question are in NEET MIND Premium.

  97. Question 97 (NEET 2023, Q194)

    Molecular Basis of InheritanceZoologyMedium
    Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?
    1. Option A: 5′ UAGCUAGCUAGCUAGCUA GCUAGC UAGC 3′
    2. Option B: 3′ UAGCUAGCUAGCUAGCUA GCUAGC UAGC 5′
    3. Option C: 5′ ATCGATCGATCGATCGATCG ATCG ATCG 3′
    4. Option D: 3′ ATCGATCGATCGATCGATCG ATCGATCG 5′

    The answer and explanation for this question are in NEET MIND Premium.

  98. Question 98 (NEET 2023, Q195)

    Structural Organisation in AnimalsZoologyMedium
    In cockroach, excretion is brought about by- A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below:
    1. Option A: A and E only
    2. Option B: A, B and E only
    3. Option C: B, C and D only
    4. Option D: B and D only

    The answer and explanation for this question are in NEET MIND Premium.

  99. Question 99 (NEET 2023, Q196)

    Cell Cycle and Cell DivisionZoologyEasy
    Given below are two statements: Statement I: During G0G_0 phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:
    1. Option A: Both Statement I and Statement II are correct.
    2. Option B: Both Statement I and Statement II are incorrect.
    3. Option C: Statement I is correct but Statement II is incorrect.
    4. Option D: Statement I is incorrect but Statement II is correct.
    Show answer & explanation

    Correct answer: (D) Statement I is incorrect but Statement II is correct.

    Explanation

    Cells in G0 phase are metabolically active but do not actively divide. Centrosome duplication occurs during the S phase of interphase. Therefore, Statement I is incorrect and Statement II is correct.

  100. Question 100 (NEET 2023, Q197)

    Principles of Inheritance and VariationZoologyEasy
    Which one of the following is NOT an advantage of inbreeding?
    1. Option A: It decreases homozygosity.
    2. Option B: It exposes harmful recessive genes that are eliminated by selection.
    3. Option C: Elimination of less desirable genes and accumulation of superior genes takes place due to it.
    4. Option D: It decreases the productivity of inbred population, after continuous inbreeding.

    The answer and explanation for this question are in NEET MIND Premium.

  101. Question 101 (NEET 2023, Q198)

    Excretory Products and Their EliminationZoologyMedium
    Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below:
    1. Option A: A and B only
    2. Option B: B, C and D only
    3. Option C: A, B and E only
    4. Option D: C, D and E only
    Show answer & explanation

    Correct answer: (B) B, C and D only

    Explanation

    Excessive loss of body fluid activates osmoreceptors, not switches them off. ADH promotes water reabsorption and increases blood pressure. ANF causes vasodilation. ADH does not directly decrease GFR. Hence B, C and D are correct.

  102. Question 102 (NEET 2023, Q199)

    Locomotion and MovementZoologyMedium
    Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:
    1. Option A: A, B and C only
    2. Option B: B and C only
    3. Option C: A, C and D only
    4. Option D: C and D only
    Show answer & explanation

    Correct answer: (B) B and C only

    Explanation

    Sarcoplasmic reticulum stores calcium ions and the striated appearance is due to actin and myosin arrangement. Fascicle is a bundle of muscle fibres, not the connective tissue layer. Sarcomere is the functional unit between two Z lines, not the M line.

  103. Question 103 (NEET 2023, Q200)

    Body Fluids and CirculationZoologyMedium
    Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs. B. Basophils secrete histamine, serotonin and heparin. C. Basophils are involved in inflammatory response. D. Basophils have kidney shaped nucleus. E. Basophils are agranulocytes. Choose the correct answer from the options given below:
    1. Option A: D and E only
    2. Option B: C and E only
    3. Option C: B and C only
    4. Option D: A and B only
    Show answer & explanation

    Correct answer: (C) B and C only

    Explanation

    Basophils secrete histamine, serotonin and heparin and participate in inflammatory responses. They are granulocytes and are not the most abundant WBCs. Kidney-shaped nucleus is characteristic of monocytes.

NEET Biology questions in other years

NEET 2022 BiologyNEET 2024 Biology

All NEET Biology PYQs, chapter-wise

Practise NEET 2023 Biology with your progress saved

A free account gives you 15 PYQs in every chapter with explanations, and keeps every mistake for revision.

Start practising free